ID: 943930516

View in Genome Browser
Species Human (GRCh38)
Location 2:193845462-193845484
Sequence TCACTTGTAAAATATAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943930515_943930516 -5 Left 943930515 2:193845444-193845466 CCAGTACATTCTTTGGGATCACT No data
Right 943930516 2:193845462-193845484 TCACTTGTAAAATATAAAACTGG No data
943930510_943930516 27 Left 943930510 2:193845412-193845434 CCTCCACTGAACTTGTGAGTGTT No data
Right 943930516 2:193845462-193845484 TCACTTGTAAAATATAAAACTGG No data
943930511_943930516 24 Left 943930511 2:193845415-193845437 CCACTGAACTTGTGAGTGTTCCT No data
Right 943930516 2:193845462-193845484 TCACTTGTAAAATATAAAACTGG No data
943930512_943930516 4 Left 943930512 2:193845435-193845457 CCTTTCTCACCAGTACATTCTTT No data
Right 943930516 2:193845462-193845484 TCACTTGTAAAATATAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943930516 Original CRISPR TCACTTGTAAAATATAAAAC TGG Intergenic