ID: 943930517

View in Genome Browser
Species Human (GRCh38)
Location 2:193845466-193845488
Sequence TTGTAAAATATAAAACTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943930511_943930517 28 Left 943930511 2:193845415-193845437 CCACTGAACTTGTGAGTGTTCCT No data
Right 943930517 2:193845466-193845488 TTGTAAAATATAAAACTGGTAGG No data
943930515_943930517 -1 Left 943930515 2:193845444-193845466 CCAGTACATTCTTTGGGATCACT No data
Right 943930517 2:193845466-193845488 TTGTAAAATATAAAACTGGTAGG No data
943930512_943930517 8 Left 943930512 2:193845435-193845457 CCTTTCTCACCAGTACATTCTTT No data
Right 943930517 2:193845466-193845488 TTGTAAAATATAAAACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943930517 Original CRISPR TTGTAAAATATAAAACTGGT AGG Intergenic