ID: 943932736

View in Genome Browser
Species Human (GRCh38)
Location 2:193875933-193875955
Sequence ATTCACTGAATTCCAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943932736_943932738 7 Left 943932736 2:193875933-193875955 CCATTCTTTGGAATTCAGTGAAT No data
Right 943932738 2:193875963-193875985 AAGCATTTTCTACATCCTGCTGG No data
943932736_943932739 13 Left 943932736 2:193875933-193875955 CCATTCTTTGGAATTCAGTGAAT No data
Right 943932739 2:193875969-193875991 TTTCTACATCCTGCTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943932736 Original CRISPR ATTCACTGAATTCCAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr