ID: 943938247

View in Genome Browser
Species Human (GRCh38)
Location 2:193954820-193954842
Sequence GGAAATATAGGTACAGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943938241_943938247 14 Left 943938241 2:193954783-193954805 CCCTCACATCACTTTGCTGTTAT No data
Right 943938247 2:193954820-193954842 GGAAATATAGGTACAGCCATAGG No data
943938240_943938247 20 Left 943938240 2:193954777-193954799 CCTACTCCCTCACATCACTTTGC No data
Right 943938247 2:193954820-193954842 GGAAATATAGGTACAGCCATAGG No data
943938242_943938247 13 Left 943938242 2:193954784-193954806 CCTCACATCACTTTGCTGTTATC No data
Right 943938247 2:193954820-193954842 GGAAATATAGGTACAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943938247 Original CRISPR GGAAATATAGGTACAGCCAT AGG Intergenic
No off target data available for this crispr