ID: 943944121

View in Genome Browser
Species Human (GRCh38)
Location 2:194036614-194036636
Sequence ATTTGCTTCGTGGCTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943944121_943944123 -5 Left 943944121 2:194036614-194036636 CCTCTTTAAGCCACGAAGCAAAT No data
Right 943944123 2:194036632-194036654 CAAATAAATGCATACATCTGTGG No data
943944121_943944124 -2 Left 943944121 2:194036614-194036636 CCTCTTTAAGCCACGAAGCAAAT No data
Right 943944124 2:194036635-194036657 ATAAATGCATACATCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943944121 Original CRISPR ATTTGCTTCGTGGCTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr