ID: 943944123

View in Genome Browser
Species Human (GRCh38)
Location 2:194036632-194036654
Sequence CAAATAAATGCATACATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943944121_943944123 -5 Left 943944121 2:194036614-194036636 CCTCTTTAAGCCACGAAGCAAAT No data
Right 943944123 2:194036632-194036654 CAAATAAATGCATACATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943944123 Original CRISPR CAAATAAATGCATACATCTG TGG Intergenic
No off target data available for this crispr