ID: 943955129

View in Genome Browser
Species Human (GRCh38)
Location 2:194178537-194178559
Sequence ATTAATGAAGAACTCACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943955129_943955135 11 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955135 2:194178571-194178593 AAGAGGATTATTGTGGGGCAGGG No data
943955129_943955134 10 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955134 2:194178570-194178592 TAAGAGGATTATTGTGGGGCAGG No data
943955129_943955136 14 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955136 2:194178574-194178596 AGGATTATTGTGGGGCAGGGTGG No data
943955129_943955133 6 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955133 2:194178566-194178588 TTTTTAAGAGGATTATTGTGGGG No data
943955129_943955131 4 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955131 2:194178564-194178586 TGTTTTTAAGAGGATTATTGTGG No data
943955129_943955130 -6 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955130 2:194178554-194178576 ATTAATTCATTGTTTTTAAGAGG No data
943955129_943955132 5 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943955129 Original CRISPR ATTAATGAAGAACTCACACA AGG (reversed) Intergenic
No off target data available for this crispr