ID: 943955132

View in Genome Browser
Species Human (GRCh38)
Location 2:194178565-194178587
Sequence GTTTTTAAGAGGATTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943955129_943955132 5 Left 943955129 2:194178537-194178559 CCTTGTGTGAGTTCTTCATTAAT No data
Right 943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943955132 Original CRISPR GTTTTTAAGAGGATTATTGT GGG Intergenic
No off target data available for this crispr