ID: 943955332

View in Genome Browser
Species Human (GRCh38)
Location 2:194181389-194181411
Sequence TTTTGTTGATGAGCTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943955329_943955332 3 Left 943955329 2:194181363-194181385 CCATTTGATCTTGAATAAAAAGT No data
Right 943955332 2:194181389-194181411 TTTTGTTGATGAGCTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943955332 Original CRISPR TTTTGTTGATGAGCTGGGCG TGG Intergenic
No off target data available for this crispr