ID: 943960439

View in Genome Browser
Species Human (GRCh38)
Location 2:194256185-194256207
Sequence CCCGGCCGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943960432_943960439 10 Left 943960432 2:194256152-194256174 CCTCTAATTGTTGGGGAAACCAG No data
Right 943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG No data
943960434_943960439 -9 Left 943960434 2:194256171-194256193 CCAGCCTCACACCACCCGGCCGG No data
Right 943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943960439 Original CRISPR CCCGGCCGGTACCCCGAGTC CGG Intergenic
No off target data available for this crispr