ID: 943964164

View in Genome Browser
Species Human (GRCh38)
Location 2:194310228-194310250
Sequence CGTTTCAATTCTTCCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943964160_943964164 8 Left 943964160 2:194310197-194310219 CCACTTCAATTCAGGTACAACTG No data
Right 943964164 2:194310228-194310250 CGTTTCAATTCTTCCTACCAGGG No data
943964158_943964164 26 Left 943964158 2:194310179-194310201 CCTGAATTCTGATCTCTTCCACT No data
Right 943964164 2:194310228-194310250 CGTTTCAATTCTTCCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943964164 Original CRISPR CGTTTCAATTCTTCCTACCA GGG Intergenic
No off target data available for this crispr