ID: 943966943

View in Genome Browser
Species Human (GRCh38)
Location 2:194348151-194348173
Sequence TACTTTTTGCAGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943966943_943966946 7 Left 943966943 2:194348151-194348173 CCCTCCAATTTCTGCAAAAAGTA No data
Right 943966946 2:194348181-194348203 TATGAAGTAAAGTGAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943966943 Original CRISPR TACTTTTTGCAGAAATTGGA GGG (reversed) Intergenic
No off target data available for this crispr