ID: 943966958

View in Genome Browser
Species Human (GRCh38)
Location 2:194348485-194348507
Sequence CTGCTGGCATTATTTAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943966958_943966961 17 Left 943966958 2:194348485-194348507 CCAATGTTAAATAATGCCAGCAG No data
Right 943966961 2:194348525-194348547 CAAAATAAACCATATCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943966958 Original CRISPR CTGCTGGCATTATTTAACAT TGG (reversed) Intergenic
No off target data available for this crispr