ID: 943969135

View in Genome Browser
Species Human (GRCh38)
Location 2:194380814-194380836
Sequence ATGCCCTTCTAGAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943969134_943969135 -5 Left 943969134 2:194380796-194380818 CCAAACGATGGAAAAATGATGCC No data
Right 943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG No data
943969133_943969135 6 Left 943969133 2:194380785-194380807 CCTCTTTTACTCCAAACGATGGA No data
Right 943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943969135 Original CRISPR ATGCCCTTCTAGAAGAATGA AGG Intergenic
No off target data available for this crispr