ID: 943971707

View in Genome Browser
Species Human (GRCh38)
Location 2:194417156-194417178
Sequence GTGGCCACTCACATGTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943971705_943971707 1 Left 943971705 2:194417132-194417154 CCATATATTTCACTGTCAAAATA No data
Right 943971707 2:194417156-194417178 GTGGCCACTCACATGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943971707 Original CRISPR GTGGCCACTCACATGTTTCA AGG Intergenic
No off target data available for this crispr