ID: 943972678

View in Genome Browser
Species Human (GRCh38)
Location 2:194431173-194431195
Sequence ATTATATTCCACATTTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943972678_943972683 26 Left 943972678 2:194431173-194431195 CCTATATAAATGTGGAATATAAT No data
Right 943972683 2:194431222-194431244 TGCGGGTCCATTAATTTACTTGG No data
943972678_943972680 8 Left 943972678 2:194431173-194431195 CCTATATAAATGTGGAATATAAT No data
Right 943972680 2:194431204-194431226 CTGATAACATCCTACTTATGCGG No data
943972678_943972681 9 Left 943972678 2:194431173-194431195 CCTATATAAATGTGGAATATAAT No data
Right 943972681 2:194431205-194431227 TGATAACATCCTACTTATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943972678 Original CRISPR ATTATATTCCACATTTATAT AGG (reversed) Intergenic
No off target data available for this crispr