ID: 943976915

View in Genome Browser
Species Human (GRCh38)
Location 2:194493655-194493677
Sequence CAGAGAAAAGAGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943976913_943976915 5 Left 943976913 2:194493627-194493649 CCACAATTGTTGTTGAAGAAGAA No data
Right 943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943976915 Original CRISPR CAGAGAAAAGAGAAGGAAGC TGG Intergenic
No off target data available for this crispr