ID: 943977415

View in Genome Browser
Species Human (GRCh38)
Location 2:194502117-194502139
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943977413_943977415 18 Left 943977413 2:194502076-194502098 CCATAAAAACATATTTCAGACTT No data
Right 943977415 2:194502117-194502139 GCTTGAGAATATGCATGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr