ID: 943980636

View in Genome Browser
Species Human (GRCh38)
Location 2:194545275-194545297
Sequence TCTTATATGATGACAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943980636_943980639 10 Left 943980636 2:194545275-194545297 CCCTCCTTTGTCATCATATAAGA No data
Right 943980639 2:194545308-194545330 AATATGAATTATAATTTTAGAGG No data
943980636_943980640 11 Left 943980636 2:194545275-194545297 CCCTCCTTTGTCATCATATAAGA No data
Right 943980640 2:194545309-194545331 ATATGAATTATAATTTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943980636 Original CRISPR TCTTATATGATGACAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr