ID: 943986219

View in Genome Browser
Species Human (GRCh38)
Location 2:194622561-194622583
Sequence TGTCAATTAGATATTTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943986217_943986219 -7 Left 943986217 2:194622545-194622567 CCAATTGTCTTATAGTTGTCAAT No data
Right 943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943986219 Original CRISPR TGTCAATTAGATATTTTGGC TGG Intergenic
No off target data available for this crispr