ID: 943992219 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:194711127-194711149 |
Sequence | GTATTTCAGTGGATTGTGAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
943992215_943992219 | 5 | Left | 943992215 | 2:194711099-194711121 | CCAAATGTCCAAATCATGAAGAA | No data | ||
Right | 943992219 | 2:194711127-194711149 | GTATTTCAGTGGATTGTGAAAGG | No data | ||||
943992216_943992219 | -3 | Left | 943992216 | 2:194711107-194711129 | CCAAATCATGAAGAATCACCGTA | No data | ||
Right | 943992219 | 2:194711127-194711149 | GTATTTCAGTGGATTGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
943992219 | Original CRISPR | GTATTTCAGTGGATTGTGAA AGG | Intergenic | ||
No off target data available for this crispr |