ID: 943992219

View in Genome Browser
Species Human (GRCh38)
Location 2:194711127-194711149
Sequence GTATTTCAGTGGATTGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943992215_943992219 5 Left 943992215 2:194711099-194711121 CCAAATGTCCAAATCATGAAGAA No data
Right 943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG No data
943992216_943992219 -3 Left 943992216 2:194711107-194711129 CCAAATCATGAAGAATCACCGTA No data
Right 943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943992219 Original CRISPR GTATTTCAGTGGATTGTGAA AGG Intergenic
No off target data available for this crispr