ID: 943993125

View in Genome Browser
Species Human (GRCh38)
Location 2:194722898-194722920
Sequence TGTTAGGCTAAAAACATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943993125_943993126 -10 Left 943993125 2:194722898-194722920 CCACTGATGTTTTTAGCCTAACA No data
Right 943993126 2:194722911-194722933 TAGCCTAACATGTACTACGTTGG No data
943993125_943993127 -9 Left 943993125 2:194722898-194722920 CCACTGATGTTTTTAGCCTAACA No data
Right 943993127 2:194722912-194722934 AGCCTAACATGTACTACGTTGGG No data
943993125_943993128 -8 Left 943993125 2:194722898-194722920 CCACTGATGTTTTTAGCCTAACA No data
Right 943993128 2:194722913-194722935 GCCTAACATGTACTACGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943993125 Original CRISPR TGTTAGGCTAAAAACATCAG TGG (reversed) Intergenic
No off target data available for this crispr