ID: 943998081

View in Genome Browser
Species Human (GRCh38)
Location 2:194797207-194797229
Sequence CCTCATGGATAGCCTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943998073_943998081 16 Left 943998073 2:194797168-194797190 CCTGGATGTCCAGGCAGAGGTGT 0: 58
1: 179
2: 957
3: 1711
4: 2033
Right 943998081 2:194797207-194797229 CCTCATGGATAGCCTCTGCCAGG No data
943998075_943998081 7 Left 943998075 2:194797177-194797199 CCAGGCAGAGGTGTGCTACAGGG 0: 6
1: 102
2: 255
3: 1431
4: 2149
Right 943998081 2:194797207-194797229 CCTCATGGATAGCCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943998081 Original CRISPR CCTCATGGATAGCCTCTGCC AGG Intergenic
No off target data available for this crispr