ID: 944004496

View in Genome Browser
Species Human (GRCh38)
Location 2:194887066-194887088
Sequence TGATTTCCAAACTTAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944004494_944004496 3 Left 944004494 2:194887040-194887062 CCACTCAGAACTAAAATGTCATG No data
Right 944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944004496 Original CRISPR TGATTTCCAAACTTAGAGTC TGG Intergenic
No off target data available for this crispr