ID: 944005278

View in Genome Browser
Species Human (GRCh38)
Location 2:194897097-194897119
Sequence AGAGAGAGTGCAACTATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944005278_944005281 20 Left 944005278 2:194897097-194897119 CCCACAATAGTTGCACTCTCTCT No data
Right 944005281 2:194897140-194897162 AGATTCCTGCTCCATGCCATGGG No data
944005278_944005280 19 Left 944005278 2:194897097-194897119 CCCACAATAGTTGCACTCTCTCT No data
Right 944005280 2:194897139-194897161 TAGATTCCTGCTCCATGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944005278 Original CRISPR AGAGAGAGTGCAACTATTGT GGG (reversed) Intergenic
No off target data available for this crispr