ID: 944026231

View in Genome Browser
Species Human (GRCh38)
Location 2:195171724-195171746
Sequence GCAGCTTGTAAGTGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944026226_944026231 10 Left 944026226 2:195171691-195171713 CCCTAGAGAGGTGAAATATTCTG No data
Right 944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG No data
944026227_944026231 9 Left 944026227 2:195171692-195171714 CCTAGAGAGGTGAAATATTCTGT No data
Right 944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944026231 Original CRISPR GCAGCTTGTAAGTGGCAAGC TGG Intergenic
No off target data available for this crispr