ID: 944031353

View in Genome Browser
Species Human (GRCh38)
Location 2:195238497-195238519
Sequence AAGTGTGCCAAAAGGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944031344_944031353 20 Left 944031344 2:195238454-195238476 CCAAGTACACCAAATAATGCCTG No data
Right 944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG No data
944031346_944031353 11 Left 944031346 2:195238463-195238485 CCAAATAATGCCTGGTGATACTA No data
Right 944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG No data
944031349_944031353 1 Left 944031349 2:195238473-195238495 CCTGGTGATACTAAAGGGAAGAG No data
Right 944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944031353 Original CRISPR AAGTGTGCCAAAAGGGAATT GGG Intergenic
No off target data available for this crispr