ID: 944031512

View in Genome Browser
Species Human (GRCh38)
Location 2:195240272-195240294
Sequence CTGGATTTAGGTAGTTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944031512_944031515 8 Left 944031512 2:195240272-195240294 CCTTTAGAACTACCTAAATCCAG No data
Right 944031515 2:195240303-195240325 TTAATATAAAGTAATATATTAGG No data
944031512_944031516 29 Left 944031512 2:195240272-195240294 CCTTTAGAACTACCTAAATCCAG No data
Right 944031516 2:195240324-195240346 GGTTGATGCAAAAGTTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944031512 Original CRISPR CTGGATTTAGGTAGTTCTAA AGG (reversed) Intergenic
No off target data available for this crispr