ID: 944032360

View in Genome Browser
Species Human (GRCh38)
Location 2:195250858-195250880
Sequence TTCATCCAATTCCACATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944032360_944032363 21 Left 944032360 2:195250858-195250880 CCTAAAATGTGGAATTGGATGAA No data
Right 944032363 2:195250902-195250924 AAATTGGCACCACACCATCCAGG No data
944032360_944032362 5 Left 944032360 2:195250858-195250880 CCTAAAATGTGGAATTGGATGAA No data
Right 944032362 2:195250886-195250908 AAAGTAGGACAGAATTAAATTGG No data
944032360_944032361 -10 Left 944032360 2:195250858-195250880 CCTAAAATGTGGAATTGGATGAA No data
Right 944032361 2:195250871-195250893 ATTGGATGAATACAGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944032360 Original CRISPR TTCATCCAATTCCACATTTT AGG (reversed) Intergenic
No off target data available for this crispr