ID: 944037728

View in Genome Browser
Species Human (GRCh38)
Location 2:195316169-195316191
Sequence ACTTGCATACTGATGGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944037728_944037730 26 Left 944037728 2:195316169-195316191 CCAACTACCATCAGTATGCAAGT No data
Right 944037730 2:195316218-195316240 AGTCTCAATTATTAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944037728 Original CRISPR ACTTGCATACTGATGGTAGT TGG (reversed) Intergenic
No off target data available for this crispr