ID: 944039497

View in Genome Browser
Species Human (GRCh38)
Location 2:195337848-195337870
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944039497_944039502 24 Left 944039497 2:195337848-195337870 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 944039502 2:195337895-195337917 TAAGATTTAAATCCCCTGTTAGG 0: 44
1: 137
2: 77
3: 55
4: 177
944039497_944039501 -3 Left 944039497 2:195337848-195337870 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 944039501 2:195337868-195337890 GGTCTGGTCGGACTTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944039497 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr