ID: 944042572

View in Genome Browser
Species Human (GRCh38)
Location 2:195372980-195373002
Sequence AACTTTCCACCTAATCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944042572_944042577 3 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042577 2:195373006-195373028 ACTTGATGGTTATTTGATGGGGG No data
944042572_944042576 2 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042576 2:195373005-195373027 AACTTGATGGTTATTTGATGGGG No data
944042572_944042579 7 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042579 2:195373010-195373032 GATGGTTATTTGATGGGGGTGGG No data
944042572_944042578 6 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042578 2:195373009-195373031 TGATGGTTATTTGATGGGGGTGG No data
944042572_944042575 1 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042575 2:195373004-195373026 CAACTTGATGGTTATTTGATGGG No data
944042572_944042574 0 Left 944042572 2:195372980-195373002 CCTCATGGATTAGGTGGAAAGTT No data
Right 944042574 2:195373003-195373025 ACAACTTGATGGTTATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944042572 Original CRISPR AACTTTCCACCTAATCCATG AGG (reversed) Intergenic
No off target data available for this crispr