ID: 944046159

View in Genome Browser
Species Human (GRCh38)
Location 2:195414181-195414203
Sequence CTGCTTTTCTTGGGCACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944046159_944046164 -8 Left 944046159 2:195414181-195414203 CCCCTTGTGCCCAAGAAAAGCAG No data
Right 944046164 2:195414196-195414218 AAAAGCAGAGAGAAGAGTAAAGG No data
944046159_944046166 -6 Left 944046159 2:195414181-195414203 CCCCTTGTGCCCAAGAAAAGCAG No data
Right 944046166 2:195414198-195414220 AAGCAGAGAGAAGAGTAAAGGGG No data
944046159_944046165 -7 Left 944046159 2:195414181-195414203 CCCCTTGTGCCCAAGAAAAGCAG No data
Right 944046165 2:195414197-195414219 AAAGCAGAGAGAAGAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944046159 Original CRISPR CTGCTTTTCTTGGGCACAAG GGG (reversed) Intergenic
No off target data available for this crispr