ID: 944048656

View in Genome Browser
Species Human (GRCh38)
Location 2:195440875-195440897
Sequence GCACTGGTGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944048656_944048663 3 Left 944048656 2:195440875-195440897 CCTGGACCTGCTAACACCAGTGC No data
Right 944048663 2:195440901-195440923 GTACACTGCCTTGGGGCCCAAGG No data
944048656_944048659 -6 Left 944048656 2:195440875-195440897 CCTGGACCTGCTAACACCAGTGC No data
Right 944048659 2:195440892-195440914 CAGTGCCATGTACACTGCCTTGG No data
944048656_944048665 17 Left 944048656 2:195440875-195440897 CCTGGACCTGCTAACACCAGTGC No data
Right 944048665 2:195440915-195440937 GGCCCAAGGACAAGTACACTTGG No data
944048656_944048660 -5 Left 944048656 2:195440875-195440897 CCTGGACCTGCTAACACCAGTGC No data
Right 944048660 2:195440893-195440915 AGTGCCATGTACACTGCCTTGGG No data
944048656_944048661 -4 Left 944048656 2:195440875-195440897 CCTGGACCTGCTAACACCAGTGC No data
Right 944048661 2:195440894-195440916 GTGCCATGTACACTGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944048656 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG (reversed) Intergenic