ID: 944056940

View in Genome Browser
Species Human (GRCh38)
Location 2:195532146-195532168
Sequence ACTCTGTTTGAATGCTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944056940_944056944 28 Left 944056940 2:195532146-195532168 CCCATAGAGCATTCAAACAGAGT No data
Right 944056944 2:195532197-195532219 GGTAATTTCCCCCAGTTCACAGG No data
944056940_944056943 7 Left 944056940 2:195532146-195532168 CCCATAGAGCATTCAAACAGAGT No data
Right 944056943 2:195532176-195532198 AAAAAGGAGCAGAAGTGTAGAGG No data
944056940_944056942 -9 Left 944056940 2:195532146-195532168 CCCATAGAGCATTCAAACAGAGT No data
Right 944056942 2:195532160-195532182 AAACAGAGTTTAAGACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944056940 Original CRISPR ACTCTGTTTGAATGCTCTAT GGG (reversed) Intergenic
No off target data available for this crispr