ID: 944056944

View in Genome Browser
Species Human (GRCh38)
Location 2:195532197-195532219
Sequence GGTAATTTCCCCCAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944056941_944056944 27 Left 944056941 2:195532147-195532169 CCATAGAGCATTCAAACAGAGTT No data
Right 944056944 2:195532197-195532219 GGTAATTTCCCCCAGTTCACAGG No data
944056940_944056944 28 Left 944056940 2:195532146-195532168 CCCATAGAGCATTCAAACAGAGT No data
Right 944056944 2:195532197-195532219 GGTAATTTCCCCCAGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944056944 Original CRISPR GGTAATTTCCCCCAGTTCAC AGG Intergenic
No off target data available for this crispr