ID: 944057969

View in Genome Browser
Species Human (GRCh38)
Location 2:195543442-195543464
Sequence GAGGGAGATGATTTCTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057969_944057974 16 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057969_944057978 30 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data
944057969_944057973 -4 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057973 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
944057969_944057975 17 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822
944057969_944057971 -5 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057971 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057969 Original CRISPR GAGGGAGATGATTTCTTTCT TGG (reversed) Intergenic
No off target data available for this crispr