ID: 944057970

View in Genome Browser
Species Human (GRCh38)
Location 2:195543460-195543482
Sequence CCTTATAAGAAGAAACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057970_944057978 12 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data
944057970_944057974 -2 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057970_944057975 -1 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057970 Original CRISPR CCTTATAAGAAGAAACATGA GGG (reversed) Intergenic
No off target data available for this crispr