ID: 944057972

View in Genome Browser
Species Human (GRCh38)
Location 2:195543461-195543483
Sequence CCCTTATAAGAAGAAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057972_944057975 -2 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822
944057972_944057974 -3 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057972_944057978 11 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057972 Original CRISPR CCCTTATAAGAAGAAACATG AGG (reversed) Intergenic
No off target data available for this crispr