ID: 944057974

View in Genome Browser
Species Human (GRCh38)
Location 2:195543481-195543503
Sequence GGGCACTAATCCCATTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7286
Summary {0: 345, 1: 994, 2: 1836, 3: 2093, 4: 2018}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057970_944057974 -2 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057972_944057974 -3 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057968_944057974 21 Left 944057968 2:195543437-195543459 CCTGGCCAAGAAAGAAATCATCT No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018
944057969_944057974 16 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057974 2:195543481-195543503 GGGCACTAATCCCATTCATGAGG 0: 345
1: 994
2: 1836
3: 2093
4: 2018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057974 Original CRISPR GGGCACTAATCCCATTCATG AGG Intergenic
Too many off-targets to display for this crispr