ID: 944057975

View in Genome Browser
Species Human (GRCh38)
Location 2:195543482-195543504
Sequence GGCACTAATCCCATTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7043
Summary {0: 378, 1: 1063, 2: 1820, 3: 1960, 4: 1822}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057972_944057975 -2 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822
944057969_944057975 17 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822
944057970_944057975 -1 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822
944057968_944057975 22 Left 944057968 2:195543437-195543459 CCTGGCCAAGAAAGAAATCATCT No data
Right 944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG 0: 378
1: 1063
2: 1820
3: 1960
4: 1822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057975 Original CRISPR GGCACTAATCCCATTCATGA GGG Intergenic
Too many off-targets to display for this crispr