ID: 944057978

View in Genome Browser
Species Human (GRCh38)
Location 2:195543495-195543517
Sequence TTCATGAGGGCTCTACTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944057969_944057978 30 Left 944057969 2:195543442-195543464 CCAAGAAAGAAATCATCTCCCTC No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data
944057970_944057978 12 Left 944057970 2:195543460-195543482 CCCTCATGTTTCTTCTTATAAGG No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data
944057972_944057978 11 Left 944057972 2:195543461-195543483 CCTCATGTTTCTTCTTATAAGGG No data
Right 944057978 2:195543495-195543517 TTCATGAGGGCTCTACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944057978 Original CRISPR TTCATGAGGGCTCTACTCTT AGG Intergenic
No off target data available for this crispr