ID: 944062456

View in Genome Browser
Species Human (GRCh38)
Location 2:195583707-195583729
Sequence CTGGAAGGGAGAAACAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944062456_944062468 28 Left 944062456 2:195583707-195583729 CCTCGTCTGTTTCTCCCTTCCAG 0: 1
1: 1
2: 2
3: 31
4: 291
Right 944062468 2:195583758-195583780 TGGCAGTGCCGCATGGTCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 112
944062456_944062463 8 Left 944062456 2:195583707-195583729 CCTCGTCTGTTTCTCCCTTCCAG 0: 1
1: 1
2: 2
3: 31
4: 291
Right 944062463 2:195583738-195583760 TGGAATGCCAGCCTTGGCAATGG No data
944062456_944062466 21 Left 944062456 2:195583707-195583729 CCTCGTCTGTTTCTCCCTTCCAG 0: 1
1: 1
2: 2
3: 31
4: 291
Right 944062466 2:195583751-195583773 TTGGCAATGGCAGTGCCGCATGG 0: 1
1: 0
2: 0
3: 8
4: 123
944062456_944062467 27 Left 944062456 2:195583707-195583729 CCTCGTCTGTTTCTCCCTTCCAG 0: 1
1: 1
2: 2
3: 31
4: 291
Right 944062467 2:195583757-195583779 ATGGCAGTGCCGCATGGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
944062456_944062462 2 Left 944062456 2:195583707-195583729 CCTCGTCTGTTTCTCCCTTCCAG 0: 1
1: 1
2: 2
3: 31
4: 291
Right 944062462 2:195583732-195583754 ATACACTGGAATGCCAGCCTTGG 0: 1
1: 0
2: 2
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944062456 Original CRISPR CTGGAAGGGAGAAACAGACG AGG (reversed) Intronic
901176078 1:7300276-7300298 CTGGAAGGGAGGACCAGAGTGGG - Intronic
901620316 1:10580016-10580038 CAGGAAGGGATAAAGAGCCGTGG + Intronic
901656640 1:10773344-10773366 CGGGCAGGTAGAGACAGACGTGG + Intronic
903986791 1:27234657-27234679 CTGGAGGAGATAAACAGAGGAGG + Exonic
904401403 1:30259025-30259047 CTGGCAGGGGGACACAGACACGG + Intergenic
904948594 1:34217491-34217513 CTGAAAGAGAGAAACAGAGGTGG + Intronic
906274834 1:44507885-44507907 CTCAAAGGGAGAAAAAGAAGGGG - Intronic
906280252 1:44548419-44548441 CTGGAAGGAAGAAACATTCCAGG - Intronic
907381193 1:54091716-54091738 CTGGAAGGGAGAAAGTAAAGGGG - Intronic
907401416 1:54227161-54227183 CTGGAAAGGAGAAGCAGAGAAGG + Intronic
907879348 1:58530875-58530897 AAGGAAGGGAAAAACAGACCCGG - Intronic
908424506 1:63992951-63992973 CTGGCAGGCAGAAAAAGACATGG - Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
910786830 1:91008086-91008108 CTGGGAGGGAAAAAGAGACTGGG + Intronic
910930551 1:92439067-92439089 CTGGATGGGAGTCACAGACTAGG + Intergenic
911252950 1:95599292-95599314 TTGGAAGAGAGAAACAGAGATGG + Intergenic
911455849 1:98122744-98122766 TTGGTAGGGAGAGACAGACAGGG - Intergenic
911466738 1:98264127-98264149 CTAGAAGGTAAACACAGACGAGG + Intergenic
911793332 1:102046408-102046430 CTGGAAGGGAGAAATTGCCAGGG - Intergenic
912469485 1:109896552-109896574 CTGCAAGTGAGAAACCAACGTGG + Intergenic
912634190 1:111276229-111276251 CTAGAAGGAAGAAAGAGAAGAGG - Intergenic
912831551 1:112957480-112957502 CTGGAAGGGAGGAAGACACGAGG - Intergenic
913169833 1:116222007-116222029 CTGGAAGGGAGGAAGTGAGGAGG + Intergenic
913489694 1:119367489-119367511 CTGGAAGGGAGAGACAGAGTCGG + Intergenic
915939051 1:160106863-160106885 CTGGAAGGGAGAGACTGATGGGG - Intergenic
915972510 1:160364608-160364630 CTGCTAGGGAGACACAGACTTGG - Intergenic
917448136 1:175123985-175124007 CTGGAAGATGGAAACAGAAGAGG - Intronic
919030766 1:192238882-192238904 GTGGAAGGGAGAATAAGAAGTGG - Intergenic
919262557 1:195216318-195216340 CTGGAAGAGAGAAACAGTAAAGG - Intergenic
920277095 1:204814408-204814430 CTGGAAGCCAGAAATAGACACGG - Intergenic
921110838 1:212035304-212035326 CTGAATGGGTGAAACAGGCGTGG - Intronic
921692483 1:218165711-218165733 CGGGAAGGAGGAAATAGACGGGG + Intergenic
922637274 1:227186510-227186532 CAGGAAGGGAGGTACAGAGGTGG + Intronic
923684064 1:236142199-236142221 CGGGAAGGGGGGAAGAGACGCGG + Intergenic
924311119 1:242744169-242744191 CAAGAAGGGAGAAAGAGACCAGG + Intergenic
1065111549 10:22444861-22444883 CTGGGAGGGAAAAAAAGAGGTGG + Intronic
1067455326 10:46415018-46415040 GTGGAAGGGAGAAGCAGAAGAGG + Intergenic
1067631878 10:47969617-47969639 GTGGAAGGGAGAAGCAGAAGAGG - Intergenic
1067862006 10:49859567-49859589 CTACAAATGAGAAACAGACGAGG + Intronic
1068962125 10:62877459-62877481 CTGGAGAGGGGAAACAGAAGGGG + Intronic
1070790895 10:79188678-79188700 CTGGAGGAGAGACACAGAAGAGG - Intronic
1072832215 10:98670753-98670775 CTGGTAGAGAGAAACAGAACAGG - Intronic
1075095620 10:119468914-119468936 CTGGAAGGGAGTAAGAGAGGAGG + Intergenic
1076067896 10:127463705-127463727 CAGGAAGGGAGAAAAGGACATGG - Intergenic
1078095101 11:8291899-8291921 CAGGAAGGCAGAAACAGGTGTGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078413326 11:11145624-11145646 TTGGAGGGGAGAAAGAAACGGGG - Intergenic
1079237504 11:18700673-18700695 CAGGAAGGGAGAAGCACACTAGG + Intronic
1079274078 11:19017318-19017340 CTGGAAGCCAGAACCAGAAGAGG - Intergenic
1079288716 11:19165945-19165967 ATGGAAGGAAGAAAGAGACAGGG + Intronic
1079392869 11:20037249-20037271 ATGGAAGGGAGTGAAAGACGGGG - Intronic
1079730359 11:23933312-23933334 ATGGAATGGAGAAATAGACCTGG - Intergenic
1081307086 11:41526153-41526175 AAAGAAGGGAGAAACAGACTGGG - Intergenic
1083857297 11:65399595-65399617 AGGGAAGGGAGAAACAGAGGTGG - Intronic
1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG + Intronic
1084267947 11:68014587-68014609 CTGGGAGGCAGAAACAGCTGTGG - Intronic
1084692023 11:70733048-70733070 CGGGGTGGGAGAGACAGACGCGG + Intronic
1085048206 11:73365482-73365504 CTGGATGGTAGAGACACACGTGG - Exonic
1085336311 11:75699340-75699362 CTGGACAGGAGAAACTGACAAGG + Intergenic
1085345670 11:75766896-75766918 CTGGGAGGTAGAAACAGGTGTGG - Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1087685093 11:101253449-101253471 CTGGAAGGGAAAAACTGGTGTGG + Intergenic
1089918084 11:122178921-122178943 CAGGAAGTGAGAAGCAGATGTGG + Intergenic
1091058541 11:132441019-132441041 CGGGCAGGGAGAAACAGATGAGG + Intronic
1092632545 12:10398034-10398056 CTGGAGGAGAGAAAAAGAGGGGG - Intronic
1093479206 12:19587185-19587207 ATGGAAGGGAGAAAGAGAAGAGG + Intronic
1093881956 12:24414873-24414895 CTGAAAAGGAGAAAAAGACAAGG - Intergenic
1094834912 12:34317783-34317805 GTGGAAGGGAAAAAAAGGCGCGG - Intergenic
1095653776 12:44645388-44645410 ATGGAAGGGAGACAAAGACAAGG + Intronic
1095737031 12:45568780-45568802 CTGGAACTGAGAAACAGCCCAGG + Intergenic
1096458509 12:51807344-51807366 CTGAAAAGGAGAAACAGCAGCGG + Exonic
1096649779 12:53056489-53056511 CTGGAAGCTAGAAAGAGACAAGG - Intronic
1096736066 12:53655857-53655879 AAGGAAGGAAGAAACAGAGGAGG + Intronic
1096849652 12:54427412-54427434 AAGGAATGGAGAAACAGACCTGG + Intergenic
1096853864 12:54463769-54463791 TTGGAAGGGAGCCACAGAAGAGG + Intronic
1099957396 12:89364011-89364033 CTGGAAGGGAGAGAGAAACTGGG + Intergenic
1100533902 12:95487615-95487637 CTGGAAGGAAGGAAAAGAAGAGG - Intronic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1108798557 13:54064790-54064812 CTGGACTGGAGAAACAGGCAGGG - Intergenic
1109115623 13:58379497-58379519 CTTGAAGGGAAAAAGAAACGGGG - Intergenic
1109276659 13:60311410-60311432 CTGGAATGGAGGAAAAGAGGAGG + Intergenic
1110763728 13:79258673-79258695 CAGGAAGTGAGAAACACATGTGG - Intergenic
1111635539 13:90898655-90898677 CTGGAGAAGAGAAACAGAAGGGG - Intergenic
1113437154 13:110302072-110302094 CTGGAAGGGAGTCCCAGCCGTGG + Intronic
1113487793 13:110667533-110667555 CTGGAAGGAATAAATAGACGAGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1118356406 14:65017430-65017452 CTGGAAGAGAGAATCACAGGGGG + Intronic
1119583618 14:75811106-75811128 GTGGGAGGGAGAAATAGAGGGGG + Intronic
1119738045 14:76996425-76996447 CTGGCAGGGAGGATCAGACTAGG + Intergenic
1119772799 14:77231565-77231587 CTGGAAGAGACACACAGACAAGG - Intronic
1119964502 14:78899188-78899210 CAGGAAGAGAGAAAAAGAAGAGG + Intronic
1121236660 14:92396395-92396417 CTGGGAAGTAGAAACAGATGAGG + Intronic
1121236813 14:92397671-92397693 CTGGAAGAGAGTGACAGACAAGG + Intronic
1122415714 14:101548628-101548650 AGGGAAGGGAGGAAGAGACGGGG + Intergenic
1122639699 14:103151627-103151649 TGGAAAGGGAGAGACAGACGAGG + Intergenic
1122861915 14:104586600-104586622 GGGGCAGGGAGCAACAGACGTGG + Intronic
1125165041 15:36693294-36693316 CTAGACTGGAGAAACAGACTTGG - Intronic
1126999358 15:54483694-54483716 CTGGGAGGCAGAGGCAGACGGGG - Intronic
1127715284 15:61643652-61643674 CTGGAAGGGAGATCCAGTCACGG - Intergenic
1127964647 15:63914517-63914539 CTGGAAGGGAGGCACAAAAGTGG + Intronic
1128723260 15:69968616-69968638 CTGGAAGGGAGACCCAGGTGGGG + Intergenic
1129711318 15:77821572-77821594 TTAGAGGGGAGAAACAGAAGAGG - Intergenic
1129844842 15:78763524-78763546 CTGCCAGGGAGAAACAGACAAGG - Intronic
1129914298 15:79254769-79254791 CTGGAAAGGAGGAAGAGAAGCGG + Intergenic
1130256981 15:82330329-82330351 CTGACAGGGAGAAACAGACAAGG + Intergenic
1130597967 15:85259659-85259681 CTGACAGGGAGAAACAGACAAGG - Intergenic
1131293601 15:91128518-91128540 CTGGGACTGAGAGACAGACGGGG - Intronic
1131809712 15:96160355-96160377 TTGGAAGGGGGAAAAAGATGAGG - Intergenic
1132498650 16:275334-275356 CTGCACGGGAGAGACAGAGGTGG + Intronic
1132635609 16:944538-944560 CTGGAAAGGAGATACATACAGGG - Intronic
1134294412 16:12932737-12932759 CTGGATGGAAGAAACAGCCCAGG - Intronic
1134844907 16:17431867-17431889 GTGGAAGGGAGAAGCAGCCATGG + Intronic
1136985802 16:35103113-35103135 CTGGAAGGGAGATAGAAAGGAGG - Intergenic
1137242893 16:46673417-46673439 CTGGAAGGGAGATAGAAAGGAGG + Intronic
1137552074 16:49444478-49444500 CAGGGAGGGAGAAACAAACGGGG - Intergenic
1139395821 16:66638091-66638113 CTGGCAGGGAGAAGCAGTCAGGG - Intronic
1139482070 16:67236217-67236239 GTGGAGGGGAGAGACTGACGTGG + Intronic
1141518469 16:84562054-84562076 CTGGGAGGGAGCAAAAGACATGG - Intergenic
1141859292 16:86705517-86705539 CTGGCAGTGAGATACAGAGGTGG + Intergenic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1144777333 17:17791473-17791495 CAGGAAGGGACAAAGAGAGGGGG - Intronic
1144961764 17:19048334-19048356 AAAGAAGGGAGACACAGACGTGG + Intergenic
1144973397 17:19126188-19126210 AAAGAAGGGAGACACAGACGTGG - Intergenic
1145050683 17:19657937-19657959 CCTGAAGGGAGAAACAAATGGGG - Intronic
1145890418 17:28410933-28410955 CTAGAAGTGAGACACAGAGGTGG - Intergenic
1145975813 17:28983756-28983778 CTTGAAGGGAAACACAGCCGGGG + Intronic
1146683802 17:34826930-34826952 CTGGAAGGCAGACCCAGAAGAGG - Intergenic
1147161248 17:38570659-38570681 CTGGGAGGGAGATAAAGACAGGG + Intronic
1147168144 17:38604276-38604298 GGGGAAGGGAGAAACAGGTGAGG - Intronic
1147310387 17:39592585-39592607 GTAGAAGGGAGAAAAAGACCTGG + Intergenic
1149002967 17:51775891-51775913 CTGAAACAGAGAAACAGAAGGGG + Intronic
1150681688 17:67289801-67289823 CTGGAAGGGAGCAGCAGGCTGGG + Intergenic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152762816 17:82118262-82118284 CTGGGAGGGAGTAAGAGAAGAGG + Intronic
1153479145 18:5529689-5529711 CTGCAAGGGAGAAGTAGAAGAGG - Intronic
1153643193 18:7173117-7173139 AGGGAGGGGAGAAACAGAAGAGG + Intergenic
1154242796 18:12667886-12667908 CAGTAAGGGAGAAACAAAGGGGG + Intronic
1154461539 18:14594481-14594503 CTGTAAGGGAGAAACAAAATTGG + Intergenic
1155519045 18:26651152-26651174 GTGGCAGGGAGATACAGAGGTGG + Intronic
1156658770 18:39320480-39320502 CTGCAAGGGAGATGCAGATGTGG + Intergenic
1157145317 18:45156766-45156788 ATGGAAGGAAGAAAAAGAGGGGG - Intergenic
1157164112 18:45342359-45342381 CTGGAAGGCAGGAACAGCAGGGG + Intronic
1157598933 18:48881108-48881130 CTGGAAGGGAGATAGAGTAGAGG - Intergenic
1160504415 18:79418996-79419018 CTGGAAAGGAGAAAACAACGTGG + Intronic
1160760539 19:782060-782082 CAGGGAGGGAGAGACGGACGGGG - Intergenic
1162838739 19:13340159-13340181 CTGAAAGGGAAAAACAGCCGAGG + Intronic
1163781430 19:19251138-19251160 CTGAAAGTGAGTAACAGACATGG - Exonic
1164610177 19:29626490-29626512 CTGGAACAGAGACACAGAGGAGG + Intergenic
1164801973 19:31084651-31084673 CTGGAAAGGAGAAACACCAGAGG - Intergenic
1165462003 19:35949444-35949466 CTGGAAGGGGGACACACACTTGG + Intergenic
1166125138 19:40710654-40710676 CTGGGAGGGAGACAGAGACATGG - Intronic
1166369100 19:42291558-42291580 CTGCACGGGAGAAACTGACTGGG - Exonic
1166445721 19:42856110-42856132 CTGCAAGGGAGAGCCAGATGGGG - Intronic
1166465385 19:43026844-43026866 CTGAAGGGGAGAGCCAGACGGGG - Intronic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1167279996 19:48561503-48561525 CTGGAAGGGAGAGAGAGAGGAGG + Intronic
1167938133 19:52923860-52923882 CTGGTAGAGAGAAACAGAACAGG - Intergenic
1168309108 19:55451883-55451905 CTGGGACAGAGAAAGAGACGTGG - Intergenic
1168632541 19:57968640-57968662 CAGGATGGGAGAAATAGACTAGG + Intronic
925412480 2:3647899-3647921 CTGTAGGGGAGAAACAGACCTGG + Intergenic
925946340 2:8867399-8867421 CTGGAGGAGAGAATCAGAAGAGG - Intronic
926365944 2:12133303-12133325 GTGAAAGGGGGAAACAGAAGAGG - Intergenic
926818947 2:16831817-16831839 TTGGGTGGGAGAAACAGAAGTGG + Intergenic
927715639 2:25350408-25350430 CAGGAAGGAAGACAGAGACGAGG - Intergenic
927946491 2:27137934-27137956 CTGGGAGGGAGAAAAGGAAGGGG + Exonic
929667803 2:43846888-43846910 CTGGTAGGGAGAAAGAAAGGTGG - Intronic
930249070 2:49014948-49014970 CTGGAAGGGAGAGATAGAGTTGG + Intronic
933636633 2:84715372-84715394 CTGGCAGGGAAAAACATATGAGG + Intronic
934919587 2:98332125-98332147 CAGGTAGGGAGAAACAGTCTTGG - Intronic
934979269 2:98826778-98826800 CTGCAAGGGAGAGACAGATCTGG + Intronic
935545509 2:104395956-104395978 CTGGAAGGGTGAAACAAGCAAGG - Intergenic
936068899 2:109352599-109352621 CAGGAAGGGAGAGAACGACGTGG - Intronic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
939184897 2:138848678-138848700 CTGCAAGAGAGAAACAAAGGGGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939884287 2:147664443-147664465 CTGAAAGGGAGAAAGTGAGGAGG - Intergenic
940929871 2:159414984-159415006 TTGGAAGGGAGAAGTAGATGAGG + Intronic
941356919 2:164504872-164504894 GTGGAAGGGAGAGGCAGAAGAGG + Intronic
942138640 2:172955330-172955352 CTGAAAAGGAGAAACAGAGACGG - Intronic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944427194 2:199595449-199595471 CTGGAAGGAAGAAACTCAAGTGG - Intergenic
944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG + Intronic
945976629 2:216276213-216276235 ATGGAAGGGGGAAACAGTGGAGG - Intronic
946142959 2:217706966-217706988 CTGGAGGGGAGAAACAGGATGGG - Intronic
946327165 2:218990683-218990705 CTGGAAGGGAGGAAATGAGGAGG - Intronic
946498389 2:220219274-220219296 ATGGAAGGGAGAAAAAAAAGAGG - Intergenic
947807041 2:232976218-232976240 GTGGAAGGGAGCAACAGAAGAGG - Intronic
948149568 2:235734309-235734331 CTGGAAGGGAGAAAGACAGGAGG - Intronic
1170588902 20:17756235-17756257 CTGGAAGGCAGGAAGAGACTCGG + Intergenic
1170697235 20:18669912-18669934 CAGGAATGGAGATACAGACCTGG - Intronic
1171393156 20:24814501-24814523 CTGGGAGGGAGAAAGAGGCATGG + Intergenic
1172198143 20:33106160-33106182 CAGGAAGAGAGAAAAAGAAGTGG - Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173434087 20:43016925-43016947 CTGAAAGGGAGAAACAGAGATGG - Intronic
1174782325 20:53401217-53401239 CTGGAGGGGAGACACAGGCTAGG + Intronic
1175093245 20:56521923-56521945 CAGTAAGGGGCAAACAGACGTGG - Intronic
1175746620 20:61461471-61461493 CTGGAAGGAAGAGACTGAGGGGG + Intronic
1176813009 21:13564111-13564133 CTGTAAGGGAGAAACAAAATTGG - Intergenic
1180084846 21:45503988-45504010 CTGCAAGAGAGAGACAGGCGGGG - Intronic
1180757639 22:18173770-18173792 CTGGAAGCCAGAAACAAATGGGG - Intronic
1181074135 22:20363675-20363697 CTGGAAGCCAGAAACAAATGGGG + Intronic
1181672340 22:24431563-24431585 CTGGAAGAGAGAGAGAGACGAGG + Intronic
1181775455 22:25156833-25156855 CTGGCAGGGAGAGAGAGACCAGG + Intronic
1181783359 22:25208489-25208511 CTGGAATGGAGTAAAAGACTGGG + Intergenic
1182400679 22:30074491-30074513 ATGGAAGGGAGAAAGAGACTTGG - Intergenic
1183268566 22:36846595-36846617 CAGGAGGGGAGAAACAGGAGAGG - Intergenic
1183386974 22:37520191-37520213 CTGCCAGGGAGGAACAGAGGAGG + Intergenic
1184409826 22:44320045-44320067 ATGGAAGGAAGAAAGGGACGGGG - Intergenic
950206074 3:11082159-11082181 CAGGAAGGGAGAAAGGGACTGGG - Intergenic
950756654 3:15178790-15178812 CTGTAAGGGAGTAACAGAAGTGG - Intergenic
950861221 3:16149173-16149195 CTGGTAGGATGAAACAGACTGGG + Intergenic
955086732 3:55709852-55709874 CTGGGAGGGAGAACGAGACAGGG + Intronic
955893054 3:63670579-63670601 CTAGAAGGGAGAATAAGAAGAGG + Intronic
960571908 3:119192790-119192812 TTGAAAGGGAGAAACTGATGAGG - Intronic
962849291 3:139295845-139295867 GTGGAAGGGAGAAGGAGACCAGG - Intronic
964575195 3:158158579-158158601 CTGGAAATGAGAAACAAACATGG + Intronic
965737631 3:171838411-171838433 CAGGAAGAGAGAAACAGTGGGGG - Intergenic
966933659 3:184691707-184691729 CTGGAAGGAATAAACTGAGGAGG - Intergenic
967516315 3:190372933-190372955 CTAGAAGGAAGAAAAAGATGAGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
971478444 4:27093370-27093392 CTGGCTGGGATAAACAGAGGCGG + Intergenic
973871752 4:55173398-55173420 CTAGAAGGGAGAAAATGACAGGG + Intergenic
974592716 4:63974383-63974405 CTGGAAAGGAGAAAAATAAGAGG - Intergenic
975266433 4:72374617-72374639 CAGGATGGAAGAAACAGAAGTGG - Intronic
975328426 4:73086425-73086447 CTGTAAGAGAGAAAAAGAAGAGG - Intronic
976572919 4:86634224-86634246 CTGTAAGGGAGAAGCAGATTTGG - Intronic
976649791 4:87422432-87422454 AAGGAAAGGTGAAACAGACGAGG - Intergenic
979953371 4:126923077-126923099 CTGGAAGGAACAAACAACCGTGG + Intergenic
980013059 4:127617919-127617941 CTGGAAAGGACACACAGAAGTGG - Intergenic
980586276 4:134820164-134820186 CTGGAAGTTAGAAAGAGACAAGG - Intergenic
980767810 4:137330919-137330941 CAGGAAGTGAGAAACAAACGAGG - Intergenic
980999654 4:139816541-139816563 GAGGAAAGGAGGAACAGACGGGG + Intronic
981235127 4:142406345-142406367 CAGGAAGGGAGAGAAAGATGAGG + Intronic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
983544306 4:168946500-168946522 ATTGAAGGCAGAAACAGATGTGG + Intronic
984039555 4:174714051-174714073 GTGGAAGGTAGAAACAGGAGAGG - Intronic
984188022 4:176570326-176570348 CAGGAAGGGAGAAAAAGCCAGGG - Intergenic
984574120 4:181427699-181427721 ATGACAGGGAGAAAGAGACGGGG + Intergenic
984995165 4:185423842-185423864 CAGGAAGGGAGAAAGAGAGCGGG + Intronic
985623024 5:965720-965742 CTCGAGGGGAGAAACAGCCCTGG + Intergenic
985676734 5:1235316-1235338 CTGAGATGGAGAAACAGACGTGG - Intronic
986343700 5:6814848-6814870 CTGGAAGCTAGAAACAGGGGTGG - Intergenic
986707561 5:10464096-10464118 GTGGAAGGGACAAGGAGACGAGG - Intronic
990549255 5:56856721-56856743 TTGGAAAGGAGAAATAGGCGAGG + Exonic
993646845 5:90473695-90473717 AGGGAAGGGTGAAACAGAAGTGG + Intronic
995400425 5:111734557-111734579 CTGGCAGGCAGAAACTGAAGAGG - Intronic
997251790 5:132394282-132394304 CAGTAAGGGAGAAACTGAAGAGG + Exonic
997982347 5:138476326-138476348 CAGGAAGACAGAAACAAACGGGG - Intergenic
998281495 5:140812344-140812366 CTGGAAGTCAGAAACAAAAGAGG - Intronic
1000373323 5:160557562-160557584 TTGGATGGGAGAGGCAGACGGGG - Intergenic
1001092836 5:168754008-168754030 CTAGAAGGAAGAAACAGAATAGG + Intronic
1001129046 5:169048123-169048145 CTAGAAAGGAGAAACTGATGAGG + Intronic
1001446697 5:171790772-171790794 CTGGAAGGCAGACACAGAAGTGG - Intronic
1001691773 5:173638705-173638727 CTGGAAGGCAGAAATAGGTGGGG + Intergenic
1002560740 5:180080308-180080330 ATGGACAGGAGAAACAGACTTGG + Intergenic
1003381401 6:5627893-5627915 TTGAAAGGGAGAAACTGACTAGG + Intronic
1004620521 6:17326756-17326778 CAGGAAAGGAGAAGCAGACAAGG + Intergenic
1006755658 6:36413045-36413067 CAGGGAGGGTGAAACAGAGGAGG + Intronic
1007745604 6:44041198-44041220 GTGGAAGAGAGAAAGAGATGGGG + Intergenic
1007752542 6:44079258-44079280 CTGTAAGGGAGAAAAGGAGGAGG - Intergenic
1008063617 6:47024896-47024918 ATGGAAGAGAGAAGCAGAAGAGG + Intronic
1008232962 6:49007688-49007710 CTGGCAGGGATGAACAGATGTGG - Intergenic
1010910541 6:81549870-81549892 CTCAAAGAGAGAAACAGAAGGGG - Intronic
1012038774 6:94176730-94176752 ATGGAAGGAAGAAACAGACAAGG - Intergenic
1015372012 6:132464927-132464949 CTGGTAGGGAGGAAGAGACAAGG - Intronic
1015886475 6:137923467-137923489 CTGGAAGGGAAATACAGCAGAGG - Intergenic
1015908110 6:138138255-138138277 CTAGAAGGGAGAAACATGGGTGG - Intergenic
1016035140 6:139376190-139376212 CAAGAAGGGGGAAAAAGACGAGG - Intergenic
1017339337 6:153302334-153302356 CTAGCAGGGAGACACAGAAGTGG - Intergenic
1017484895 6:154893435-154893457 TTGGGAGGGAGAAAAAGAGGTGG - Intronic
1017885422 6:158595784-158595806 CTGGAAGGGAGCATCAAGCGGGG + Intronic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1021290296 7:18835317-18835339 CTGAAAGGGAGAAAGAAAAGAGG + Intronic
1024243477 7:47452961-47452983 CTGGAAGGGAAAAGCAGCCCTGG - Intronic
1024527355 7:50360149-50360171 CTGGAAGGGAGGGACAGCAGAGG + Intronic
1024924435 7:54598530-54598552 CTGGAAGGGAGGAACACATTGGG - Intergenic
1026014521 7:66662547-66662569 CTGGAAGGTAGAGACAGGCAGGG + Intronic
1027236913 7:76303675-76303697 CTGGTAGGGATTAACAGAGGGGG - Intronic
1027802151 7:82767992-82768014 AGGGAAGGGAGAAAGAGACAGGG + Intronic
1029484857 7:100833992-100834014 CTGGAAGGTAGAAAATGACTTGG - Intronic
1029580968 7:101436392-101436414 CACGAGGGGAGAAACAGACTGGG - Intronic
1029607062 7:101605620-101605642 CAGGAAGAGAAAAACAGACACGG + Intergenic
1029728292 7:102423034-102423056 GTGGAAGGGAGCAACAGAGGAGG - Intronic
1031215170 7:118881276-118881298 AGGGAAGGGAGAAGCAGTCGCGG + Intergenic
1032341987 7:131082508-131082530 AAGAAAGGGAGAAACAGAGGTGG - Intergenic
1032700703 7:134376407-134376429 CTGGGAGAGAGAAGCAGACTTGG + Intergenic
1033384290 7:140856274-140856296 AGGGAAGGGAGAGACAGAAGTGG + Intronic
1033463322 7:141567460-141567482 GGGGAAGGGAGAAAAAGAAGGGG - Intronic
1035420967 7:158729102-158729124 CTGGAGGGGAGGGGCAGACGTGG + Intergenic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1036665887 8:10738071-10738093 CTGGAAAAGAGAAACAAATGAGG + Intronic
1036672172 8:10798050-10798072 CTAGAAGTGAGGAATAGACGGGG + Intronic
1037701554 8:21279570-21279592 CTGTAAGGGAAGAGCAGACGGGG - Intergenic
1038086706 8:24206087-24206109 CTTCAAGGGAAAAACAGATGAGG + Intergenic
1039231222 8:35450782-35450804 CTGCAAGTGAGAAACAGAATAGG - Intronic
1039416453 8:37398664-37398686 CTGGAAGGGAGGAAAAGTCTCGG + Intergenic
1039716231 8:40112582-40112604 CTGGCAGGGAGAAACTCATGGGG + Intergenic
1041854475 8:62435033-62435055 CAGACAGGGAGAAACAGAGGAGG + Intronic
1042620786 8:70701446-70701468 CTCTAAGAGAGAAACAGAAGGGG - Intronic
1042867847 8:73371146-73371168 GTGCAATGGAGAAACACACGGGG - Intergenic
1044136933 8:88597885-88597907 GTGGAAGGGAGATAGAGAAGAGG - Intergenic
1047024987 8:120814482-120814504 CTGGGAGGGAGACACTGAGGAGG + Intergenic
1047573977 8:126132871-126132893 CTGGCAAGGAGAAACACATGAGG + Intergenic
1047652141 8:126934309-126934331 ATGGAAGAGAGAAATAGACTAGG + Intergenic
1049614176 8:143569065-143569087 CTGGGAGGGAGAAACTGGAGGGG + Intronic
1049775420 8:144401674-144401696 CTGGAGGGGAGAGAAAGACAGGG + Intronic
1051731746 9:20151032-20151054 ATGGAAAGCAGAAACAGACTTGG - Intergenic
1052721657 9:32178638-32178660 ATGGGAGGGAGAAGCAGATGTGG + Intergenic
1052739088 9:32376119-32376141 CTGGAAGGGGGATGCAGATGAGG + Intergenic
1053483303 9:38432566-38432588 CTGGAAGGATGATACAGAAGGGG + Intergenic
1055486204 9:76759152-76759174 CAGGGAGGGAGACCCAGACGGGG - Intronic
1055808851 9:80127646-80127668 CTGGGAGGGAGCATAAGACGTGG + Intergenic
1057062661 9:92019541-92019563 CAGGTGAGGAGAAACAGACGAGG + Intergenic
1058070496 9:100596835-100596857 CTGGAATGCAGAAACTGAGGAGG - Intergenic
1059942812 9:119374349-119374371 CTGCTAGGGAGAAAAAGACCTGG - Intergenic
1060268634 9:122126567-122126589 GGGGAAGGGAGACAGAGACGGGG + Intergenic
1060786300 9:126453980-126454002 GTCTAAGTGAGAAACAGACGCGG + Intronic
1062317479 9:135975336-135975358 CTTGGAGGGAAAAACAGATGGGG - Intergenic
1062378684 9:136276419-136276441 CTGGCAGGGAGAGAAAGTCGGGG - Intergenic
1187445846 X:19360322-19360344 CTGGAATGGTGAAACAAACAAGG - Exonic
1187966698 X:24619085-24619107 CTAGAAGGGAGAAAAAGAAAGGG + Intronic
1188643871 X:32539903-32539925 CTGGAGGGAAAAAACAGACCAGG + Intronic
1194374796 X:93118967-93118989 CGGGAAGGGAGAAAAAGAGAGGG + Intergenic
1197441525 X:126496429-126496451 GAGGAAGGGAGAAGCAGAAGAGG - Intergenic
1199712494 X:150480057-150480079 CTGGAAGTGAGAGTCAGAAGTGG - Intronic
1200682818 Y:6233030-6233052 CGGGAAGGGAGAAAAAGAGAGGG + Intergenic