ID: 944069989

View in Genome Browser
Species Human (GRCh38)
Location 2:195657564-195657586
Sequence GCGAGGCTCCGCACGCGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944069989_944069998 5 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944069998 2:195657592-195657614 CCTCACCTTCCTGTGGAGGTTGG 0: 1
1: 0
2: 12
3: 368
4: 10500
944069989_944070004 29 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944070004 2:195657616-195657638 GGAGCCTCGCGGGCCGCGCCCGG No data
944069989_944069999 8 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944069999 2:195657595-195657617 CACCTTCCTGTGGAGGTTGGCGG 0: 1
1: 0
2: 0
3: 19
4: 227
944069989_944069993 1 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944069993 2:195657588-195657610 CCCCCCTCACCTTCCTGTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 384
944069989_944070002 18 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944070002 2:195657605-195657627 TGGAGGTTGGCGGAGCCTCGCGG 0: 1
1: 0
2: 4
3: 10
4: 161
944069989_944070003 19 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944070003 2:195657606-195657628 GGAGGTTGGCGGAGCCTCGCGGG 0: 1
1: 0
2: 3
3: 8
4: 139
944069989_944070005 30 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944070005 2:195657617-195657639 GAGCCTCGCGGGCCGCGCCCGGG No data
944069989_944069991 -2 Left 944069989 2:195657564-195657586 CCACTTCGCGTGCGGAGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 944069991 2:195657585-195657607 GCGCCCCCCTCACCTTCCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944069989 Original CRISPR GCGAGGCTCCGCACGCGAAG TGG (reversed) Intronic
901201123 1:7467973-7467995 GCGGGGCTCCGCATGCGACACGG + Intronic
904643019 1:31944716-31944738 GCGTGGGTCCGCGCGCGGAGGGG + Intronic
907444530 1:54499414-54499436 GCGTGGCTCCGCAGGGCAAGAGG + Intergenic
1064397863 10:14995961-14995983 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1066975935 10:42367755-42367777 GCTAGGCTCCGCTGCCGAAGCGG - Intergenic
1084228386 11:67732034-67732056 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1084228409 11:67732112-67732134 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1084806774 11:71584617-71584639 GCGAGGCGCCCCCCGCGATGCGG + Intronic
1086216778 11:84392235-84392257 GCGAGGCTCTGCACGCTAGCGGG - Intronic
1089499932 11:118925868-118925890 GCGAGGCTCCGGCAGCGCAGGGG - Intronic
1092433033 12:8424180-8424202 GCGAGGCGCCCCACGCGATGCGG - Intergenic
1094514974 12:31120802-31120824 GGGAGGCTCCCCCCGCGAAGCGG + Intergenic
1094515420 12:31122694-31122716 GGGAGGCACCGCCCGCGAGGCGG + Intergenic
1096103015 12:48980699-48980721 GAGAGGCTCCGCACCCTAAGCGG + Intronic
1097212928 12:57386387-57386409 GGCAGGCTCCGCACTCGGAGAGG + Intronic
1103521263 12:121537964-121537986 TCGAGCCTCCGCAGCCGAAGGGG - Intronic
1107545164 13:41428015-41428037 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1107545193 13:41428097-41428119 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1109537540 13:63739253-63739275 GGGAGGCACCCCTCGCGAAGCGG - Intergenic
1117037498 14:51743758-51743780 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1117037732 14:51744793-51744815 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
1134325848 16:13206962-13206984 GCGAGGCTCAGAAAGGGAAGTGG - Intronic
1149491167 17:57085897-57085919 GCGAGGCTCCAGAAGTGAAGGGG - Exonic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929075660 2:38076977-38076999 GCCCAGCTCCGCACGCAAAGGGG - Intronic
942368687 2:175257288-175257310 GGCAGGATCCGCACTCGAAGCGG - Intergenic
944069989 2:195657564-195657586 GCGAGGCTCCGCACGCGAAGTGG - Intronic
1171346366 20:24469357-24469379 GGCAGGCTCGGCAAGCGAAGAGG + Exonic
949883551 3:8678731-8678753 GGGAGGCACCACACGCGAGGCGG + Intronic
950549013 3:13655271-13655293 GCGAGGCTCGGCCGGCCAAGGGG + Intergenic
961274430 3:125715906-125715928 GCGAGGCGCCCCCCGCGATGTGG + Intergenic
961277347 3:125738458-125738480 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
961277396 3:125738619-125738641 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
961877030 3:130031049-130031071 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
961877076 3:130031207-130031229 GCGAGGCGCCCCTCGCGATGCGG - Intergenic
968462605 4:732835-732857 ACCAGCCTCCGCACGCGGAGCGG + Intronic
968989308 4:3898239-3898261 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
969270684 4:6098146-6098168 GTGAGCCACCGCACGCGACGAGG - Intronic
1020312148 7:6876347-6876369 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1029079219 7:97959179-97959201 GCGAGGCGCCCCCCGCGATGTGG - Intergenic
1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG + Intronic
1056864792 9:90219875-90219897 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
1061040681 9:128139165-128139187 GGGAGGCACCTCACGCGAGGCGG - Intergenic