ID: 944083981

View in Genome Browser
Species Human (GRCh38)
Location 2:195822591-195822613
Sequence TTGCTGGGATTGATTAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944083981_944083985 9 Left 944083981 2:195822591-195822613 CCCTGTTTAATCAATCCCAGCAA No data
Right 944083985 2:195822623-195822645 ATAAAGCAATAAGACACTCTAGG No data
944083981_944083987 19 Left 944083981 2:195822591-195822613 CCCTGTTTAATCAATCCCAGCAA No data
Right 944083987 2:195822633-195822655 AAGACACTCTAGGGATCTTAAGG No data
944083981_944083988 20 Left 944083981 2:195822591-195822613 CCCTGTTTAATCAATCCCAGCAA No data
Right 944083988 2:195822634-195822656 AGACACTCTAGGGATCTTAAGGG No data
944083981_944083986 10 Left 944083981 2:195822591-195822613 CCCTGTTTAATCAATCCCAGCAA No data
Right 944083986 2:195822624-195822646 TAAAGCAATAAGACACTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944083981 Original CRISPR TTGCTGGGATTGATTAAACA GGG (reversed) Intronic
No off target data available for this crispr