ID: 944086297

View in Genome Browser
Species Human (GRCh38)
Location 2:195851369-195851391
Sequence TCATCTCTGTGAAGGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944086297_944086304 13 Left 944086297 2:195851369-195851391 CCTTCAAGCCTTCACAGAGATGA No data
Right 944086304 2:195851405-195851427 GAAGTGACTACTTGAATCAAGGG No data
944086297_944086303 12 Left 944086297 2:195851369-195851391 CCTTCAAGCCTTCACAGAGATGA No data
Right 944086303 2:195851404-195851426 TGAAGTGACTACTTGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944086297 Original CRISPR TCATCTCTGTGAAGGCTTGA AGG (reversed) Intronic