ID: 944086297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:195851369-195851391 |
| Sequence | TCATCTCTGTGAAGGCTTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944086297_944086304 | 13 | Left | 944086297 | 2:195851369-195851391 | CCTTCAAGCCTTCACAGAGATGA | No data | ||
| Right | 944086304 | 2:195851405-195851427 | GAAGTGACTACTTGAATCAAGGG | No data | ||||
| 944086297_944086303 | 12 | Left | 944086297 | 2:195851369-195851391 | CCTTCAAGCCTTCACAGAGATGA | No data | ||
| Right | 944086303 | 2:195851404-195851426 | TGAAGTGACTACTTGAATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944086297 | Original CRISPR | TCATCTCTGTGAAGGCTTGA AGG (reversed) | Intronic | ||