ID: 944090509

View in Genome Browser
Species Human (GRCh38)
Location 2:195904700-195904722
Sequence AGGGAGCAGCAAGGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944090509 Original CRISPR AGGGAGCAGCAAGGTGTGGC AGG Intronic
900467481 1:2832912-2832934 CGGGACCAGCAGGGTGGGGCGGG - Intergenic
900778779 1:4603738-4603760 AGGGAGCAGCGAGTTGGGGAGGG - Intergenic
900859515 1:5218105-5218127 GGGGAGGAGTCAGGTGTGGCTGG - Intergenic
901636793 1:10674292-10674314 AGGGAGCAGGCAGGTGAGGCAGG - Intronic
901776421 1:11563377-11563399 AGGGACAAGGAAGGTGGGGCAGG + Intergenic
901805269 1:11734848-11734870 AGGGAGGTGCCAGGTGAGGCAGG + Intergenic
902224827 1:14990155-14990177 AGGGATCAGCAAACTGTGGCTGG + Intronic
902326819 1:15706283-15706305 AGTGAGGAGCCTGGTGTGGCTGG - Intronic
902695830 1:18140345-18140367 AGGGAGCAGGAAGGCAGGGCAGG - Intronic
903218081 1:21854171-21854193 GGTGAGGAGCCAGGTGTGGCTGG - Exonic
903232648 1:21931356-21931378 CGGGAGCAGGAGGGGGTGGCAGG + Intronic
903418443 1:23200969-23200991 TGGGAGAGGCATGGTGTGGCTGG - Intergenic
904050503 1:27635320-27635342 AGGGAGGAGGAAGGTGGGGGCGG - Intergenic
904083270 1:27885494-27885516 AGGAAGCAGCAAGGTAGGGAGGG - Intronic
904353222 1:29922364-29922386 AGGGTTCTCCAAGGTGTGGCAGG + Intergenic
904591890 1:31619505-31619527 AGGGTGCAGCGAGGTGAAGCTGG - Intronic
904612547 1:31733360-31733382 AGGGACCAGGAAGGTGGGGAAGG + Intronic
905254014 1:36668456-36668478 AGGGAGCAGGGAGGTGAGACAGG + Intergenic
907311977 1:53543988-53544010 ATGGAGAACCAAGGGGTGGCGGG + Intronic
907622790 1:55998598-55998620 AGGGGACAGCAAGCTATGGCCGG + Intergenic
909120389 1:71596017-71596039 AGGGAGGGGCAGGGTTTGGCAGG - Intronic
909593542 1:77379148-77379170 AGGAAGGAGCACTGTGTGGCAGG + Intronic
910547438 1:88433604-88433626 AGGGAGGGGCACAGTGTGGCTGG + Intergenic
911182664 1:94875154-94875176 AGGGAGCAGCAGAGTGTAGGCGG - Intronic
912402671 1:109408335-109408357 AGGGAGCAGAAAGGTATTCCAGG - Intronic
912468986 1:109893708-109893730 AGGGACCAGCAAGGAGTCGAGGG + Intergenic
912625615 1:111203198-111203220 GGGAAGGAGCAGGGTGTGGCAGG + Intronic
912757053 1:112333299-112333321 AGGGAAAAGCAAGGGGTGGGAGG - Intergenic
913564204 1:120055631-120055653 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
913633920 1:120737934-120737956 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914284792 1:146214979-146215001 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914340029 1:146752562-146752584 AGGCAGCAGCAGGGTGTTGTAGG - Intergenic
914545823 1:148665718-148665740 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914620740 1:149404948-149404970 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914827518 1:151146369-151146391 AGGGAGCAGGAGGGCGCGGCCGG - Intronic
915290280 1:154878752-154878774 AGGAAGCAGAAAGCTGAGGCCGG - Intergenic
915349384 1:155214950-155214972 AGGGAGCAGGAAGGTGTTCAGGG - Intergenic
915352570 1:155235577-155235599 AGGGAGCAGGAAGGTGTTCAGGG - Intronic
915510016 1:156381780-156381802 AGGGAAGAGCAAGGTGTTGGAGG - Intronic
915590935 1:156869886-156869908 AGGGACCAGGAATGTGTGCCTGG + Intronic
917453973 1:175170201-175170223 AGAGGGCAGCCAAGTGTGGCTGG + Intronic
917922159 1:179759626-179759648 AGGGAGGTGCAAGGTGGGACTGG + Intronic
918145388 1:181751563-181751585 AGGAGACAGCAAGGTGAGGCAGG - Intronic
918346299 1:183610197-183610219 GGGCAGGAGCAGGGTGTGGCTGG + Intergenic
919426445 1:197438074-197438096 AGGGAGCAGCAAGTCTTGGCAGG + Intronic
919791093 1:201291480-201291502 AGGCAGGTGCAGGGTGTGGCGGG + Intronic
919802728 1:201363267-201363289 AGGGAGCAGCAGGGGTTGCCAGG - Intronic
920717665 1:208355993-208356015 AGGGAGCAGCTTGGGGTGGGAGG + Intergenic
921110762 1:212034789-212034811 AGGGAGCAGCTTGGTGTAGAGGG - Intronic
922031279 1:221802019-221802041 AGGTAGCAGTAGGGTGGGGCTGG + Intergenic
922887609 1:229032004-229032026 AGGGACCAACAAGGCGTTGCTGG + Intergenic
924610253 1:245567627-245567649 GGGGAGCAGCATGGTTTGGTTGG - Intronic
1062860113 10:804332-804354 ACGGAGCTGCAGGGTGGGGCGGG + Intergenic
1067057394 10:43060353-43060375 AGGCTGCAGCAAGCTGGGGCCGG + Intergenic
1067242474 10:44508311-44508333 AGGCACCAGCAAGGGGTGGTAGG - Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067476330 10:46569358-46569380 AGTGAGCAACAAGGTATGGAGGG + Intergenic
1067544902 10:47185442-47185464 AGAGAGCTGCAAGGTGTAGCAGG - Intergenic
1067618406 10:47772422-47772444 AGTGAGCAACAAGGTATGGAGGG - Intergenic
1068673042 10:59743214-59743236 TGGAAACAGCAAGGTGTGGTGGG - Intergenic
1068889179 10:62131069-62131091 AGGGAGCAGGAAAGTGAGTCAGG + Intergenic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1072696744 10:97609513-97609535 AGGCAGCAGAAAGGTGTTCCAGG - Intronic
1072940640 10:99760555-99760577 AGGGAGCAGCATCCTGAGGCAGG + Intergenic
1073355239 10:102848528-102848550 AGGGAGCAGCAAGGTGACAGTGG + Intergenic
1074125091 10:110522442-110522464 AGAGAGCAGCAAAGTGTCCCTGG - Intergenic
1074293786 10:112162944-112162966 TGGGAGGAGCAAGGTGAGGGAGG + Intronic
1074600647 10:114909910-114909932 AGGGAGCAGGATGGGGTGGGAGG + Intergenic
1075336642 10:121613563-121613585 AGGGAGCACCAGGGAGTGCCAGG - Intergenic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1075857097 10:125638752-125638774 AGGGAGCAGGTTGGGGTGGCAGG - Intronic
1076175961 10:128367918-128367940 AGTTGGCAGCAAGGGGTGGCAGG + Intergenic
1076478614 10:130769426-130769448 GGGAAGCAGCCAGGGGTGGCTGG - Intergenic
1076485024 10:130810342-130810364 AGGGAGCAGCCAGGGGTAGTGGG - Intergenic
1076642707 10:131929647-131929669 ATGGAGCGGGCAGGTGTGGCGGG - Intronic
1076713312 10:132350933-132350955 AGGGAGCTGACAGGTGTGCCTGG - Intronic
1076910992 10:133389451-133389473 AGTGAGCAGCAGAGTGTGTCAGG - Intronic
1076922199 10:133459876-133459898 AGGGAGCCTCAGGGTGCGGCTGG + Intergenic
1077042337 11:530300-530322 AGTGACCAGCACGGTGTGGAAGG + Intergenic
1077168437 11:1153991-1154013 AGGGAGGAGAAAGCTGTGGCTGG + Intergenic
1077233635 11:1469610-1469632 AGGCAGCAGGAAGGGGTGACAGG + Intronic
1077236304 11:1483564-1483586 AGGGAGGAGGGAGGTGAGGCTGG - Intronic
1077268683 11:1665117-1665139 AGGGAGCAGCAGGGTGTCCCAGG + Intergenic
1077272092 11:1686186-1686208 AGGGAGCAGCAGGGTGTCCCAGG - Intergenic
1077315662 11:1918370-1918392 AGGGACAGGCAAGGTGTGCCTGG - Intergenic
1077424272 11:2467091-2467113 TCGGAGGAGCAAGCTGTGGCTGG + Intronic
1077434395 11:2531805-2531827 GGTGAGACGCAAGGTGTGGCAGG - Intronic
1077482855 11:2824688-2824710 AGGAAGCAGCTGGGGGTGGCGGG + Intronic
1077550110 11:3196465-3196487 AGGGAGAAGCAAGGTCGTGCAGG - Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078507665 11:11964772-11964794 AGGGGGCATGAAGGTGAGGCTGG - Intronic
1079083284 11:17428534-17428556 TGGGAGTAGCAAGGGGAGGCCGG + Intronic
1079383057 11:19955941-19955963 AGGTTCCAGCAGGGTGTGGCAGG + Intronic
1081581065 11:44352349-44352371 AGGGAGCAGACGGGTGTAGCAGG + Intergenic
1083494196 11:63036066-63036088 AGGGGGCAGGAAGGAATGGCAGG - Intergenic
1083596484 11:63920356-63920378 AGGGAGCGGCAAGGGGAGGCCGG - Intergenic
1083602926 11:63960207-63960229 CAGGAGTAGCAAGGTGGGGCAGG - Intergenic
1083725400 11:64625383-64625405 AGAGAGCAGCCCAGTGTGGCTGG + Intronic
1083890398 11:65592935-65592957 AGGAAGCAGCCAGGAGTGGCTGG - Exonic
1084030471 11:66477874-66477896 GGGGAACAGCATGGTGTGGCAGG + Intergenic
1084383268 11:68826897-68826919 AGACAGCAGCCAGGTGAGGCAGG + Intronic
1084399351 11:68934741-68934763 AGGGCGGGGCAAGGTGGGGCGGG - Intronic
1084657581 11:70528291-70528313 TGGAAGCAGGAAGGTTTGGCAGG + Intronic
1084659274 11:70537572-70537594 GGGCTGCAGCCAGGTGTGGCAGG - Intronic
1084751491 11:71207020-71207042 AGGGTGCAGCAAGCTATGACTGG + Intronic
1084790283 11:71471210-71471232 AGGTGGCAGGAAGGTGAGGCTGG + Intronic
1085312923 11:75526445-75526467 AGGGAGAAGCAAGGTGTCGGTGG - Intergenic
1085880336 11:80459975-80459997 AAGAAGTAGGAAGGTGTGGCTGG - Intergenic
1086455532 11:86955683-86955705 AGGGGGCAGGACGGCGTGGCTGG - Intergenic
1087093418 11:94298412-94298434 AGGGAGTAGCTCAGTGTGGCTGG + Intergenic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089682726 11:120128366-120128388 AGGGAGCAGCAAGGTGAGCTTGG + Intronic
1089775025 11:120830049-120830071 AGGGAGCTGGAGGCTGTGGCAGG - Intronic
1090238246 11:125164992-125165014 AGGGAGCAGCGAGGGACGGCGGG + Intronic
1090412751 11:126520332-126520354 AGGGGGCAGCGAGGTGGGGCAGG + Intronic
1091237523 11:134032022-134032044 AGGCAGCCCCAAGGTGTGTCAGG - Intergenic
1091405848 12:209078-209100 AGTGAGGAGGCAGGTGTGGCTGG - Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091644479 12:2263336-2263358 AGGGAGGAGGCAGGTATGGCTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1094846972 12:34365584-34365606 AGGGAGCAGGAAGGCGTGATAGG - Intergenic
1097196996 12:57248337-57248359 AGAGACCAGCAAGGGGTAGCTGG + Intronic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1101431905 12:104633882-104633904 AGGGAACAGAGAGGTGGGGCAGG - Intronic
1102770335 12:115470678-115470700 GGTGGGCAGGAAGGTGTGGCGGG - Intergenic
1103322532 12:120100347-120100369 TTGAAGCTGCAAGGTGTGGCAGG - Intronic
1104233703 12:126910775-126910797 GGGAAGCAGGAAAGTGTGGCCGG + Intergenic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104891797 12:132143817-132143839 AGGGAGCAGCGAGGAGGCGCCGG - Exonic
1104958445 12:132477048-132477070 AGGGAGGAGGAAGGTGCGGCCGG - Intergenic
1106686341 13:32064171-32064193 GGGGAGTACCAAGGAGTGGCTGG + Intronic
1106693010 13:32139320-32139342 AGGGTGCAGAAAGGTGCGTCGGG - Intronic
1107797068 13:44063693-44063715 GTTGAGCAGCAAGGTGGGGCAGG + Intergenic
1108466017 13:50715907-50715929 GGGTAGCAGCAAGGTGTGCCAGG - Intronic
1108677633 13:52750983-52751005 AGGGAGCAGAAAGGGGAGGCAGG - Intergenic
1112333875 13:98498360-98498382 TAAGAGCAGCTAGGTGTGGCTGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113327481 13:109295814-109295836 TTGCAGCAGCCAGGTGTGGCTGG - Intergenic
1113667616 13:112151849-112151871 AGGGTGCAGCTAAGTGGGGCAGG - Intergenic
1114556979 14:23567729-23567751 AGGCAGAAGCCAGGTGAGGCTGG - Exonic
1114626341 14:24132495-24132517 GGTGAGCAGGAAGGTGTGGGAGG - Exonic
1116421033 14:44732500-44732522 ATGGGGCAGCAAGGAATGGCAGG - Intergenic
1117474268 14:56078054-56078076 ATGCAGCAGGGAGGTGTGGCTGG + Intergenic
1117998363 14:61499498-61499520 AGGGAGGAGCAAGATGTGAGGGG - Intronic
1118346208 14:64942947-64942969 AGGTTGCAGCAGGGTGGGGCGGG - Intronic
1119516746 14:75254448-75254470 ATGGGCCAGCCAGGTGTGGCTGG - Intronic
1119884574 14:78129621-78129643 ACGGAGCAGCAAGGAGGAGCAGG + Intergenic
1120541258 14:85753647-85753669 ATGGAGGAGCAAGTTGTGGTTGG + Intergenic
1121977198 14:98416277-98416299 AGGGAGCACAAGGGTGTGGTGGG - Intergenic
1122826695 14:104374145-104374167 AGGGAGCAGGAAGGTGAGGGTGG - Intergenic
1122836405 14:104432986-104433008 AGGGAGCCGCCAGGTGCTGCTGG - Intergenic
1122891353 14:104733631-104733653 AGAGAGCAGTGGGGTGTGGCTGG + Intronic
1123035678 14:105470956-105470978 AGGGGGCAGCAAGCGGTTGCAGG + Intergenic
1124618885 15:31262796-31262818 AGGGTACAGCCTGGTGTGGCAGG + Intergenic
1125548387 15:40525703-40525725 AGGGAGAAACAAGGGGTGTCAGG - Intergenic
1126689221 15:51274965-51274987 AGGGAGAGCCCAGGTGTGGCTGG - Intronic
1127633483 15:60848044-60848066 AGTGAGCAGCAAGCGGGGGCTGG - Intronic
1128223147 15:65982602-65982624 AGGTGGCAGCAAGGGGTGCCTGG + Intronic
1128580051 15:68803349-68803371 TGGCAGCAGCAAGGTGTTCCAGG + Intronic
1128776027 15:70321250-70321272 AGGGACCAGGAAGGGGAGGCTGG + Intergenic
1128808990 15:70556238-70556260 TGGGAGCAGCGGGGAGTGGCAGG - Intergenic
1129112989 15:73349002-73349024 AGGCAGCAGTAAGGGATGGCTGG - Intronic
1129184057 15:73894915-73894937 AGCGAGCACCAGGGTCTGGCAGG - Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129853897 15:78811067-78811089 GGGGAGCGGGAAGGGGTGGCAGG + Intronic
1130320398 15:82836434-82836456 AGGAAGCAGCATGGTATTGCTGG - Intergenic
1131674290 15:94655269-94655291 GGAGGGCAGCAAGGGGTGGCGGG + Intergenic
1132543566 16:522722-522744 AGACAGCATCAAGGTGGGGCAGG + Exonic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132880092 16:2158331-2158353 AGGGTGCAGCCAGGTGGGGCAGG + Intronic
1132945928 16:2531511-2531533 AGGGAGCGGAATGGTGGGGCAGG - Intergenic
1132950906 16:2562052-2562074 AGGCAGCGCCAGGGTGTGGCTGG + Intronic
1132953126 16:2576105-2576127 AGGGAGCTGCAGGGTCTGGGAGG + Intronic
1132961224 16:2624063-2624085 AGGGAGCTGCAGGGTCTGGGAGG - Intergenic
1132963443 16:2638118-2638140 AGGCAGCGCCAGGGTGTGGCTGG - Intergenic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133855249 16:9543590-9543612 AGGGAGGAGGCAAGTGTGGCTGG - Intergenic
1135573314 16:23565990-23566012 AGGGGGCAGCAAGGGATGCCTGG - Intronic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137433139 16:48434508-48434530 GGGGAGGAGCCAGATGTGGCTGG - Intronic
1137835882 16:51592053-51592075 CCGGAGCAGCAAGGTGTGTCCGG + Intergenic
1139994259 16:70964846-70964868 AGGCAGCAGCAGGGTGTTGTAGG + Exonic
1140891511 16:79289192-79289214 AGGGAGTGGCACGGTGTGACTGG + Intergenic
1141089064 16:81117568-81117590 AGGGAGCAGCCCTGTGGGGCGGG - Intergenic
1141815852 16:86408833-86408855 AGGGAGTAGGGAGGTGAGGCTGG - Intergenic
1142211374 16:88810238-88810260 AGGTAACAGCAAGGTGGGGTTGG - Intronic
1143163617 17:4886702-4886724 GGGGAGCAGGAAGGGGTGCCAGG - Intronic
1144589966 17:16515476-16515498 AGGAAGCAGCACAGTGTGGTAGG - Intergenic
1144754703 17:17672056-17672078 TGGGAACAGCGAGGTGTGGGAGG + Intergenic
1145251070 17:21297337-21297359 AGCCAGCAGCAGGGAGTGGCGGG + Intronic
1146289234 17:31596277-31596299 GGGGAGCAGGAATGCGTGGCAGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146827240 17:36033434-36033456 ATGGAGCAGCATGGTGGGGAAGG - Intergenic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147758644 17:42783836-42783858 AGGCGGCAGCAGGGTGCGGCAGG + Intronic
1147833112 17:43311076-43311098 AGGCTGCAGCAAGATGTGACTGG - Intergenic
1148775554 17:50093567-50093589 AGGCAGCAGACAGGTATGGCTGG + Intergenic
1149243920 17:54682947-54682969 AAGGGGCAGTAAGATGTGGCAGG - Intergenic
1149597304 17:57872015-57872037 GGGGAGGAGCAAGTTGTGGAGGG - Intronic
1152295993 17:79467210-79467232 GGGAAGCAGCACGGTGTGGCTGG - Intronic
1152425198 17:80214803-80214825 AGGGAGCAGAAAGGGTTGGGAGG - Intronic
1152457914 17:80426673-80426695 ACTCAGCAGGAAGGTGTGGCCGG + Intronic
1153343700 18:4003723-4003745 AGGGAGCAGCAAGTGGATGCTGG + Intronic
1155263058 18:24063660-24063682 AGTTAGCAGCAAGTGGTGGCGGG - Intronic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1156261177 18:35446126-35446148 AGGGAGCCCCAAGCTGTGCCAGG + Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1156498096 18:37538996-37539018 TGAGAGCAGCAGGGTGGGGCAGG - Intronic
1156915985 18:42464856-42464878 AGGTAAAAGCAAGGAGTGGCTGG - Intergenic
1157569514 18:48703316-48703338 TTGGAGCTGCAAGGTGTGCCTGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1159600356 18:70423324-70423346 AGGAAGCACCAGGGTGTGTCGGG + Intergenic
1159813868 18:73049327-73049349 AGGTAAAACCAAGGTGTGGCAGG + Intergenic
1160871062 19:1278266-1278288 AGGGAACAGCAGGGAGCGGCCGG + Intronic
1161183868 19:2903003-2903025 AGGGTGCAGCGGGGTCTGGCTGG + Intronic
1162069196 19:8143431-8143453 TGTGAGCAGTGAGGTGTGGCAGG - Intronic
1162460236 19:10810405-10810427 AGGGAGCTGCAAGCTGTGGGTGG - Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163028533 19:14528634-14528656 AGGGCGGAGCAAAGTGTGGAGGG + Intronic
1163695442 19:18761233-18761255 ACGGAGCAGCAACGTGGGCCAGG - Intronic
1164721896 19:30438566-30438588 AGGGAGCAGCATGGTCTGAAAGG + Intronic
1165356108 19:35305145-35305167 AGGGAGCTGGCAGGTGGGGCAGG - Intronic
1165797512 19:38527620-38527642 AGGGAGGAAGAAGGAGTGGCCGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166742407 19:45122376-45122398 AAGGAACAGGAAGGTGGGGCTGG - Intronic
1167551414 19:50163270-50163292 AGGGAGCATCACGGTGTTACAGG + Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925098103 2:1223681-1223703 AGGGAGGAGCCAGGCGTGTCTGG + Intronic
925443779 2:3910281-3910303 AGGGACCAGCCAGGCGTGGTGGG + Intergenic
926611265 2:14950703-14950725 AGGGTGCACCAAGCTGAGGCTGG + Intergenic
927327055 2:21817297-21817319 ATTCAGCAGCAATGTGTGGCTGG + Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
927510896 2:23643025-23643047 AGGGAGGGGGAAGGTGTGGAGGG + Intronic
928022615 2:27716010-27716032 AGGGAGCAGAGAGGGGTGGAAGG - Intergenic
928219961 2:29395425-29395447 AGGGCATAGCAAGGTGTGGGTGG - Intronic
928319737 2:30273561-30273583 AGGGATCAGCAAGGCCTGGAGGG + Intronic
929322027 2:40555796-40555818 AGGGAACAGCAAGGTGGTGGTGG + Intronic
929574299 2:43042335-43042357 AGGGAGGAGAGAGGTGAGGCTGG + Intergenic
930223949 2:48773357-48773379 AGGGTGCAGGAAGGAGTGGCTGG + Intronic
932086786 2:68769686-68769708 AGGGAGCAACTAAGTCTGGCAGG + Intronic
932169386 2:69539722-69539744 AGGGAACAGCAAGGTGTGTGGGG - Intronic
932231607 2:70088056-70088078 AGGGAGCCGCACTGGGTGGCCGG - Exonic
934975199 2:98797290-98797312 AGGGAGCAGCCAGCTGGGACTGG - Intronic
935679615 2:105624672-105624694 AGGGCTCAGCCAGGTGTTGCTGG - Intergenic
935744135 2:106176154-106176176 GGGGAGCAGCCAGGGGTGGGGGG - Intronic
937119572 2:119432121-119432143 CGGGAGCAGCTATGTGAGGCAGG - Intronic
937124065 2:119462069-119462091 AGGGAGCAACAGGGTGTTGTAGG + Intronic
937224251 2:120359197-120359219 GGTGAGCAGCACGGGGTGGCAGG - Intergenic
937302095 2:120848805-120848827 AGGAAGAAGGAAGGAGTGGCAGG + Intronic
937306811 2:120876731-120876753 AGGGAGGAGCAAGGTTCTGCTGG + Intronic
937318636 2:120947810-120947832 GGGATGCAGCAAGGTGGGGCAGG - Intronic
937439845 2:121906339-121906361 AGGCAGCGGCAGGGTGGGGCGGG - Intergenic
938149050 2:128865481-128865503 GGAGACCAGCAAGGTGTGCCTGG + Intergenic
938248737 2:129797825-129797847 TGGGAGCCACAAGGTGTGGGAGG + Intergenic
938537092 2:132256291-132256313 AGGGAGCAGCTTGGGGTGGTGGG + Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
940488799 2:154330240-154330262 AGGGAGCAGCAAGTGGTGGAGGG + Intronic
940887158 2:159000099-159000121 AGGGAGTAGCCAGGTGAGGTGGG + Intronic
941970207 2:171341932-171341954 AGGGAGAGGAAAGGAGTGGCTGG + Intronic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
943226709 2:185187591-185187613 AGGGAGGAACAAGGCCTGGCTGG - Intergenic
943862949 2:192892148-192892170 GGGGAGCAGGAAGGTGTGGGGGG + Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
946110127 2:217407800-217407822 AGGTAGCAGCAGGGTGGGGTAGG - Intronic
946410614 2:219513518-219513540 AGGGAGCAGGAAGATGTGCTGGG - Intergenic
947101088 2:226621913-226621935 AGGGAGAGGCATGGTGTGACAGG - Intergenic
947534323 2:230931484-230931506 AGGGTTCAGCAAGGTGGGACAGG - Intronic
947612239 2:231531297-231531319 GGGGAGCAGGAGGCTGTGGCTGG - Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
948231353 2:236351663-236351685 GGGGAGCAGGCAGGTGTGGGCGG + Intronic
948596584 2:239083291-239083313 AGGGAGCAGGTAGGAGTGCCTGG - Intronic
948809340 2:240466839-240466861 AGGGCGCAGGGAGGTGGGGCCGG - Exonic
1168765548 20:379923-379945 ATGGAGCAGGAAGTTGAGGCAGG + Intronic
1168888355 20:1276087-1276109 AGGGAACAGGAGGGTGTGGAGGG - Intronic
1169147064 20:3259681-3259703 GGGGAGCAACAGGGTGTGGCGGG - Intronic
1169340087 20:4789997-4790019 AGGGATCAGCAAGATGGGGTGGG + Intronic
1170800117 20:19583715-19583737 AGGGAGCTGCGAGCTGTGTCAGG + Intronic
1171866005 20:30488070-30488092 AGGGAGCAGCTCGGGGTGGTGGG + Intergenic
1172150116 20:32784458-32784480 AGCGAGCAGCTAGGTCTGGCTGG - Intronic
1172501933 20:35433817-35433839 AGGGGTCAGGAAGCTGTGGCAGG - Exonic
1173464025 20:43267248-43267270 AGCCAGTAGCAAGGTGTGGATGG + Intergenic
1173907896 20:46642085-46642107 GGGGAGCAGCAGGGTCTGTCGGG - Intronic
1174572370 20:51511188-51511210 AGGGAGCAACAGGGGGTGGTGGG - Intronic
1175084226 20:56445394-56445416 AGGGACCAACAAGGTCTGGGAGG - Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1175978906 20:62727313-62727335 AGGGAGCAGCAAGGGCTGGGTGG + Intronic
1175984832 20:62759425-62759447 AGGCAGCTGCAAGGAGAGGCAGG + Intronic
1176263538 20:64196287-64196309 AGGGATCACCAAGGTGAGCCTGG + Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1178451760 21:32708137-32708159 AGGGAGTAGTAAGGTGGGGGTGG + Intronic
1178608184 21:34057435-34057457 AGGGAGCAGGAAGGCCAGGCTGG - Intergenic
1178854938 21:36242635-36242657 AGGAAGCAGCAAGGTAGTGCTGG - Intronic
1179503551 21:41824762-41824784 AGTGAGCAGGGAGGTGTGGCTGG - Intronic
1179550107 21:42138363-42138385 CATGAGCAGCAAGGTGTGGGGGG - Intronic
1179575779 21:42307450-42307472 ACCGAGCACCAAGGTGTGGCTGG - Intergenic
1179613775 21:42568899-42568921 AGGGAGCAGGCAGGTGGAGCTGG + Intronic
1179875110 21:44263111-44263133 AGGGAGCAGGAAGGTGGGGTGGG + Intergenic
1180071299 21:45436954-45436976 GGGGAGCAGCTGGCTGTGGCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180731192 22:17983744-17983766 AGAGAGGATGAAGGTGTGGCGGG - Intronic
1180879695 22:19195193-19195215 AGGCAGCAGCCACGTGTGCCAGG + Intronic
1180922184 22:19526596-19526618 ACGGTGCAGCAAGGTGTTCCTGG - Exonic
1181572234 22:23773834-23773856 AGGGAGCAGGAGGGTGTGACAGG + Intronic
1181931568 22:26405800-26405822 AAGGGGCAGGAAGGTGTGGAGGG + Intergenic
1182541265 22:31043811-31043833 AGGGAGCAGGAAGGGGTGGCTGG + Intergenic
1183409188 22:37645043-37645065 AGGTAGCAGGAAGCTGTGGATGG + Intronic
1183633337 22:39046450-39046472 AGGGTGCAGCAAGGTCTGGAGGG - Intronic
1184396666 22:44246077-44246099 CTGGAGCAGCCAGGTGAGGCGGG + Exonic
1184866169 22:47202831-47202853 ACGGAGCAGCCAGCTGTAGCGGG - Intergenic
950026167 3:9821262-9821284 AGGGAGGATCAAGGTGAGCCTGG + Intronic
950335169 3:12187559-12187581 GTGGAGCAGCCAGGGGTGGCTGG - Exonic
950867999 3:16204786-16204808 GGGGAGAAGCAATGTGGGGCAGG + Intronic
952924081 3:38308702-38308724 AGGGAGCAGCCAGGTGGAGCGGG + Intronic
953004499 3:38965548-38965570 AGAGAAGAGCAAGATGTGGCTGG - Intergenic
953481636 3:43257146-43257168 AGTGAGCAGCAAGCAATGGCAGG + Intergenic
953497736 3:43402932-43402954 AGGAAGCATCATGCTGTGGCTGG + Intronic
953781148 3:45872042-45872064 AGGTGGCAGCAAGGAATGGCAGG + Intronic
954106736 3:48413646-48413668 TGGGTGCAGCCAGATGTGGCTGG - Intronic
954407597 3:50354174-50354196 AGGGAGCAGCCAGGGGTCGGGGG - Intronic
954415905 3:50393246-50393268 AGGGAGGAGCAGGGTGGGGGTGG - Intronic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
955467875 3:59255086-59255108 AGGGAGCAGCAAGGTCCCTCAGG - Intergenic
959338701 3:105099672-105099694 AAGAAGCAGCAAGGTGTGCTGGG + Intergenic
961817517 3:129558873-129558895 AGGGAGGAGCCAGGGGTGCCCGG - Intronic
962077043 3:132093226-132093248 AGGGGGCAGCAAATTTTGGCTGG - Intronic
962198403 3:133381944-133381966 AGGCAGCAGCAAGGAGAAGCTGG - Intronic
963814337 3:149813000-149813022 AGGGAAGAGCAGGGTGGGGCAGG - Exonic
967888841 3:194351039-194351061 AGGCAGGAGGAAGGTGGGGCGGG - Intronic
968449446 4:668427-668449 TGGGAGCAGCATGGGGTAGCGGG - Intronic
968449502 4:668633-668655 TGGGAGCAGCATGGGGTAGCGGG - Intronic
968491425 4:892506-892528 AGGGAGCAGCACGTGTTGGCTGG - Intronic
968529559 4:1083789-1083811 GGGGAGCTGCAGGTTGTGGCTGG + Intronic
969243401 4:5916667-5916689 AGGGAGCAGGGAGGTGAGACAGG + Intronic
969246190 4:5934524-5934546 AGGGTGCAGGGAGGAGTGGCAGG - Intronic
969681520 4:8645815-8645837 GGGGAGGAGCGTGGTGTGGCTGG + Intergenic
970342585 4:15122013-15122035 AGAGTGAAGCAAGGTGTGACAGG - Intergenic
970448390 4:16142812-16142834 AGAGGGCAGCCAGGTGTGGTTGG + Intergenic
970608877 4:17707541-17707563 AGGGAGCAGAGAGGAGGGGCAGG - Intronic
971092535 4:23361646-23361668 ATGGAGCAGCAAGGGGTGTGTGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972322119 4:37981647-37981669 AGGGAGAAGGGAGGTATGGCTGG + Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974211639 4:58784145-58784167 TGGGAGCAGAAACGTCTGGCAGG - Intergenic
975649963 4:76583145-76583167 GGGGAGCAGCGTGGTGTGGATGG + Intronic
975994900 4:80302817-80302839 AGCTTGCAGCAAGGTGTGGAGGG + Intronic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
980994430 4:139766597-139766619 AGAAAGCAGCTGGGTGTGGCCGG - Intronic
981497662 4:145411927-145411949 AGGCAGCAAGAAGGTGTGGGGGG + Intergenic
982997918 4:162374820-162374842 AAGGAGCAGGAAGGGGTTGCTGG - Intergenic
984405082 4:179319061-179319083 ATGTAGCAGTTAGGTGTGGCGGG + Intergenic
985590131 5:760187-760209 AGGAAACAGCCAGGTGTGGAGGG + Intronic
985631228 5:1015087-1015109 GGAGAGCAGCCAGGTGTGGCCGG + Intronic
985785169 5:1889562-1889584 ATGGAGCACCAAGGTGGGGGAGG - Intergenic
985900042 5:2780965-2780987 GTGGAGCAGAAAGGTGAGGCAGG - Intergenic
986453172 5:7887051-7887073 AAGGAGCAGCAATGTGTAGCTGG - Intronic
988812273 5:34797304-34797326 AGGGATCAGCCAGGTATTGCAGG + Intronic
992027428 5:72684444-72684466 AGGAAGCAGAAATGTGAGGCAGG + Intergenic
992372929 5:76163593-76163615 ATGGAGCACCAAGGTGGTGCTGG - Intronic
993280357 5:85918959-85918981 GGCGAGCAACAGGGTGTGGCTGG + Intergenic
995495645 5:112739296-112739318 AGGGAGTGGGGAGGTGTGGCAGG - Intronic
995672456 5:114622008-114622030 AAGGAGCAGCCAGGTCTTGCTGG - Intergenic
995991211 5:118241865-118241887 AGGGAGCAGGGGTGTGTGGCAGG - Intergenic
996793256 5:127316200-127316222 AGGGAGCATCCAGGAGGGGCTGG - Intronic
997248426 5:132370549-132370571 AGGGAGGAGCACACTGTGGCTGG - Intronic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997529200 5:134571781-134571803 AGGGAGCAGTGAGGAGTGTCGGG - Intronic
998545165 5:143021554-143021576 ATGGAGGAGTAATGTGTGGCTGG + Intronic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
1000482488 5:161796504-161796526 AAGGAACAGCAATGTGTGCCTGG + Intergenic
1001506212 5:172283171-172283193 AGGGTGCGGAAAGATGTGGCGGG + Intronic
1002327224 5:178417703-178417725 AGCGGGCAGCAAGGTGAGGGAGG - Intronic
1002522974 5:179801517-179801539 AGGGAGGAGCACGGGGTGGGGGG - Intronic
1003094530 6:3131922-3131944 AGGCACGTGCAAGGTGTGGCGGG - Intronic
1003206981 6:4021518-4021540 TGGGAGCTGCACGGGGTGGCGGG + Intronic
1004199502 6:13534650-13534672 AGGGAGCAGCCCGACGTGGCTGG + Intergenic
1004455877 6:15790983-15791005 AGGGAGAAGCAATGCTTGGCAGG + Intergenic
1006642660 6:35496948-35496970 AGGGAGCCGCAAGGGGGGCCGGG + Exonic
1006986446 6:38178730-38178752 TGGGAGCAGCAGGGTGTGGGGGG + Intronic
1007402867 6:41614368-41614390 AGGGAGCAGGCAGGAGAGGCAGG + Intergenic
1007733347 6:43965206-43965228 AGGGTGCAGCAAGTTGGGGTGGG - Intergenic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008539548 6:52534825-52534847 AAGGAGCAGCAAGGCCAGGCAGG - Intronic
1010134264 6:72532091-72532113 AGGGAGCCACAGGGAGTGGCAGG - Intergenic
1013731198 6:113169484-113169506 TGGGAGCAGAAGGGAGTGGCTGG + Intergenic
1013971798 6:116029026-116029048 ATGGAGGAGCTTGGTGTGGCTGG - Intronic
1015970870 6:138741589-138741611 AGGAAGCATCAATGTGTGGTGGG - Intergenic
1018749968 6:166795833-166795855 TGGGAGCAGAAAGGTGTCCCTGG + Intronic
1018827779 6:167422159-167422181 AGGGAGCCGCCATGTGTGGGGGG - Intergenic
1018827991 6:167422742-167422764 AGGGAGCCGCCATGTGTGGGGGG - Intergenic
1019147884 6:169986559-169986581 AGAGAGCAGCAAGGGGTGGCTGG - Intergenic
1019156690 6:170044011-170044033 AGGGAGCAGCCCCGTGTGGAGGG - Intergenic
1019164209 6:170087805-170087827 TGGGAGGAGCATGGTGTGGGGGG + Intergenic
1019164277 6:170087971-170087993 TGGGAGGAGCGTGGTGTGGCGGG + Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1019575992 7:1737926-1737948 AGGGAGCTGGAAGGGGTGGCCGG - Intronic
1020119480 7:5495158-5495180 AGGGAGCAGAATGGGGAGGCTGG - Intronic
1021781274 7:24109117-24109139 AGGGAGCAGGAATGAGGGGCAGG - Intergenic
1021954513 7:25810922-25810944 AAGAAGCAGCAAGGTGGGTCTGG - Intergenic
1022090367 7:27104026-27104048 AAGGATCAGGAAGGTGTGGGAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023291486 7:38672726-38672748 AGGGAGATCCAGGGTGTGGCTGG - Intergenic
1026212722 7:68321159-68321181 GTGGAGCAGCAAGGTGTGGTAGG - Intergenic
1026769620 7:73187152-73187174 TGGGAGGAGCAAGGTGGGGGAGG + Intergenic
1026945740 7:74314856-74314878 AGGGGGCAGCAAGATGGGACTGG - Intronic
1027010489 7:74740538-74740560 TGGGAGGAGCAAGGTGGGGGAGG + Intronic
1027077553 7:75205506-75205528 TGGGAGGAGCAAGGTGGGGGAGG - Intergenic
1028956738 7:96701943-96701965 GAGGGGCAGCATGGTGTGGCTGG + Intronic
1029238379 7:99142621-99142643 AGGGAGGAGGACGGTGTGGGGGG + Intronic
1029803837 7:102976361-102976383 AGGGAGCAGAAAAGTGGAGCGGG - Intronic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1031560356 7:123230825-123230847 AGCGAGCACCCAGGTGAGGCCGG - Intergenic
1032078626 7:128847883-128847905 AGGGAGGAGGGAGGTGGGGCGGG + Intronic
1032878177 7:136060071-136060093 AGAAAGCAGTCAGGTGTGGCTGG + Intergenic
1033069437 7:138188689-138188711 AGGGAGCAGCAAAGGCTGGAGGG + Intergenic
1033588987 7:142795378-142795400 TGGGAGGAGCGAGGGGTGGCAGG - Intergenic
1034593344 7:152163264-152163286 ATGGAGCAGCATGGTATGGTGGG - Exonic
1034871895 7:154692571-154692593 AAGAAGCAACAAGGTGTTGCGGG + Intronic
1035224599 7:157426439-157426461 GGGGAGCAGCATGGAGGGGCGGG - Intergenic
1035345141 7:158192610-158192632 ATGGAGCAGCAAGGCCAGGCCGG - Intronic
1035459896 7:159032144-159032166 AGGGGGCAGCTGGGTGTGGGAGG + Intronic
1035469344 7:159099790-159099812 AGGGAGCAGCCAGGGGTCTCAGG - Intronic
1036757499 8:11480995-11481017 CAGGAGCAGGAGGGTGTGGCTGG - Intergenic
1037152355 8:15653172-15653194 AGGAAGCAGTATGGTGTGGGTGG + Intronic
1038701975 8:29857336-29857358 AGGCAACAGCCAGGAGTGGCAGG - Intergenic
1039591834 8:38756501-38756523 AGGGAGTTGCTAGGTGTAGCTGG + Intronic
1041020237 8:53631644-53631666 AGGAAGCACCAAGGTGGGCCAGG + Intergenic
1041097735 8:54366184-54366206 AGGGAGCAGCAGGGAGTGAAGGG - Intergenic
1042763055 8:72291464-72291486 AGGCAGCAGCGAGGTGAGGGAGG + Intergenic
1044446883 8:92288586-92288608 AGGAAGCTGGAAGGGGTGGCTGG + Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1044912248 8:97072645-97072667 TGAGAGCAGCAGGGTGTGCCTGG - Intronic
1045012399 8:97969559-97969581 AGGGAGCAGGAAGTAGGGGCAGG + Intronic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1045689926 8:104749779-104749801 AGTGAGAAGCTTGGTGTGGCTGG + Intronic
1047360719 8:124166445-124166467 AGGTAGCAGCAGGGTGGGGCTGG - Intergenic
1047906510 8:129478903-129478925 AGGTAGCAGCAACGAATGGCAGG + Intergenic
1048808754 8:138265661-138265683 AGGGAACAGCTACTTGTGGCTGG + Intronic
1049090763 8:140511847-140511869 AGGGAGCGGCGAGGGGTGGGCGG - Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049157301 8:141074972-141074994 AGGCAGCAGCATGGAGTGCCTGG - Intergenic
1049260418 8:141636063-141636085 AGCGGGCAGCAAGGGGTGCCAGG + Intergenic
1050484082 9:6115341-6115363 ATGGAGCAGTAAGGTGTGTGTGG - Intergenic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1052728933 9:32262717-32262739 ATGGAGCAGCAATGAGGGGCAGG - Intergenic
1053009061 9:34623293-34623315 TGGGAGCAGTAAGGTCTGACGGG - Intronic
1053355154 9:37439220-37439242 AGAGGACAGCAAGGTGAGGCTGG + Exonic
1053576469 9:39360270-39360292 AGGGACCAGCAAGCTGTGTAAGG - Exonic
1054098039 9:60918961-60918983 AGGGACCAGCAAGCTGTGTAAGG - Intergenic
1054119440 9:61194591-61194613 AGGGACCAGCAAGCTGTGTAAGG - Exonic
1054588314 9:66987971-66987993 AGGGACCAGCAAGCTGTGTAAGG + Intergenic
1054594913 9:67055636-67055658 AGGGAACACAAAGGTCTGGCAGG - Intergenic
1054935634 9:70684432-70684454 AGGGAGGACCAAGGGGAGGCTGG + Intronic
1055785363 9:79864619-79864641 AGGAGGCTGCAAGGTGTGGTGGG - Intergenic
1056083649 9:83123372-83123394 AGGGAACAGCAAAGTGGGTCTGG - Intergenic
1056496233 9:87157971-87157993 AGGGAGCAGGAAGGTGGGGCAGG + Exonic
1056838971 9:89982356-89982378 AGGGAGAAGAAAGGTTTGGAAGG - Intergenic
1057199239 9:93131546-93131568 GAGGGGCAGGAAGGTGTGGCTGG + Intronic
1057246343 9:93458280-93458302 TGGGAGCGGCAAGGAGTGACAGG - Intronic
1057988051 9:99737736-99737758 AGTGAGGAGACAGGTGTGGCAGG - Intergenic
1058413748 9:104763942-104763964 AGGGCCCAGAAAGGTGGGGCAGG + Intergenic
1058444333 9:105041055-105041077 AGGAAGCAGCAAAGTGGGGGTGG - Intergenic
1060279233 9:122204819-122204841 GGGGGGCAGCAGGGTGGGGCAGG - Intronic
1060853546 9:126897076-126897098 AGAAATCAGCCAGGTGTGGCCGG - Intergenic
1060933500 9:127503290-127503312 AGGGAGCAGGAGGGCCTGGCTGG + Exonic
1061709502 9:132477901-132477923 AGAGAGCAGGCAGCTGTGGCAGG - Intronic
1061928472 9:133819629-133819651 AGGGAGCCTAAGGGTGTGGCAGG - Intronic
1062139838 9:134949871-134949893 AGGGAGCCCCAAAGTGGGGCTGG + Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1191756565 X:64599023-64599045 AGGCAATAGCAAGGTGTGGTGGG - Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1192175530 X:68882591-68882613 ACGGAGCAGCAATGGGTGGTTGG - Intergenic
1192803091 X:74485793-74485815 CGGGAGCAGCAATGGGTGCCTGG + Intronic
1193600705 X:83505986-83506008 AGGCAGCTGCAAGGTGGGGGTGG + Intergenic
1195260213 X:103124486-103124508 AGGGAGAAGAAAGGTGGGCCTGG + Intergenic
1195633320 X:107084252-107084274 ATGTAGTAGCAAGGTGTGGAAGG + Intronic
1197173134 X:123456564-123456586 AGGGAGGGGTAAGGTGTGGCTGG - Intronic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1198541550 X:137645153-137645175 AGGGGGTACCAAGGTGAGGCTGG - Intergenic
1198710293 X:139494552-139494574 GGGGAGGAGCAGGGTGTGGTAGG - Intergenic
1198960266 X:142175349-142175371 AGTGAGCAGGAAGGGGTGGAGGG - Intergenic