ID: 944091248

View in Genome Browser
Species Human (GRCh38)
Location 2:195914446-195914468
Sequence TATAGGTTCTTCAAGTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944091244_944091248 28 Left 944091244 2:195914395-195914417 CCACTGGGTACAAGGTACAGCTG No data
Right 944091248 2:195914446-195914468 TATAGGTTCTTCAAGTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944091248 Original CRISPR TATAGGTTCTTCAAGTGATT GGG Intronic
No off target data available for this crispr