ID: 944091474

View in Genome Browser
Species Human (GRCh38)
Location 2:195916732-195916754
Sequence TCCCGAGTAGCAAGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535136
Summary {0: 11, 1: 1925, 2: 65852, 3: 194383, 4: 272965}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944091474_944091479 8 Left 944091474 2:195916732-195916754 CCTGTAGTCCTTGCTACTCGGGA 0: 11
1: 1925
2: 65852
3: 194383
4: 272965
Right 944091479 2:195916763-195916785 CAGGAGAGTCATTTGAAGCCTGG No data
944091474_944091480 14 Left 944091474 2:195916732-195916754 CCTGTAGTCCTTGCTACTCGGGA 0: 11
1: 1925
2: 65852
3: 194383
4: 272965
Right 944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944091474 Original CRISPR TCCCGAGTAGCAAGGACTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr