ID: 944091476

View in Genome Browser
Species Human (GRCh38)
Location 2:195916740-195916762
Sequence CCTCAGCCTCCCGAGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743682
Summary {0: 458, 1: 103146, 2: 288681, 3: 226598, 4: 124799}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944091476_944091479 0 Left 944091476 2:195916740-195916762 CCTTGCTACTCGGGAGGCTGAGG 0: 458
1: 103146
2: 288681
3: 226598
4: 124799
Right 944091479 2:195916763-195916785 CAGGAGAGTCATTTGAAGCCTGG No data
944091476_944091480 6 Left 944091476 2:195916740-195916762 CCTTGCTACTCGGGAGGCTGAGG 0: 458
1: 103146
2: 288681
3: 226598
4: 124799
Right 944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944091476 Original CRISPR CCTCAGCCTCCCGAGTAGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr